Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 11, Number 3—March 2005


Rapid Identification of Emerging Pathogens: Coronavirus

Rangarajan Sampath*Comments to Author , Steven A. Hofstadler*, Lawrence B. Blyn*, Mark W. Eshoo*, Thomas A. Hall*, Christian Massire*, Harold M. Levene*, James C. Hannis*, Patina M. Harrell*, Benjamin Neuman†, Michael J. Buchmeier†, Yun Jiang*, Raymond Ranken*, Jared J. Drader*, Vivek Samant*, Richard H. Griffey*, John A. McNeil*, Stanley T. Crooke*, and David J. Ecker*
Author affiliations: *Ibis Therapeutics, Carlsbad, California, USA; †The Scripps Research Institute, La Jolla, California, USA

Main Article

Table 2

PCR primer pairs used in this study*

Primer name Gene name Product name Genome coordinates Orientation Product
length (bp) Sequence (5′ to >3′)
RdRp primer ORF 1b Nsp12-pp1ab (RdRp) 15146–15164 Sense 88 TAAGTTTTATGGCGGCTGG
Nsp14 primer ORF 1b Nsp14-pp1ab (nuclease ExoN homolog) 19113–19138 Sense 137 TGTTTGTTTTGGAATTGTAATGTTGA

*All coordinates are based on SARS TOR2 genome (GenBank accession no. NC_004718.3). 5′ propynyl-modified pyrimidine nucleotides are shown in bold. Each primer was designed to include a thymidine (T) nucleotide on the 5′ end to minimize addition of nontemplated adenosine (A) during polymerase chain reaction (PCR) (data not shown). RdRp, RNA-dependent RNA polymerase.

Main Article

Top of Page The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO