Volume 16, Number 5—May 2010
Dispatch
La Crosse Virus in Aedes albopictus Mosquitoes, Texas, USA, 2009
Amy J. Lambert
, Carol D. Blair, Mary D’Anton, Winnann Ewing, Michelle Harborth, Robyn Seiferth, Jeannie Xiang, and Robert S. Lanciotti
, Carol D. Blair, Mary D’Anton, Winnann Ewing, Michelle Harborth, Robyn Seiferth, Jeannie Xiang, and Robert S. LanciottiTable
Orthobunyavirus consensus oligonucleotide primers used for amplification and sequencing of La Crosse virus partial S, M, and L segment cDNAs, Texas, 2009*
| Targeted genomic regions | Name | Primer sequence (5′ → 3′) | Approximate amplicon size, bp |
|---|---|---|---|
| S segment nucleocapsid ORF | Cal S forward | GCAAATGGATTTGATCCTGATGCAG | 210 |
| Cal S reverse |
TTGTTCCTGTTTGCTGGAAAATGAT |
||
| M segment 5′ terminus/glycoprotein ORF | Ortho M 5′ terminus | AGTAGTGTACTACC | 410 |
| Ortho M ORF reverse |
TTRAARCADGCATGGAA |
||
| L segment 5′ terminus/polymerase ORF | Ortho L 5′ terminus | AGTAGTGTACTCCTA | 550 |
| Ortho L ORF reverse | AATTCYTCATCATCA |
*Oligonucleotide primers designed against conserved regions of the orthobunyavirus genome. S segment primers appear in a previous publication (9). All primers were applied in singleplex reactions using methods described previously (9) with altered primer annealing conditions of 50oC for 1 min. S, small; M, medium; L, large; ORF, open reading frame.
