Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 17, Number 12—December 2011

Research

Novel Multiplexed HIV/Simian Immunodeficiency Virus Antibody Detection Assay

Steve Ahuka-Mundeke, Ahidjo Ayouba, Placide Mbala-Kingebeni, Florian Liegeois, Amandine Esteban, Octavie Lunguya-Metila, Didace Demba, Guy Bilulu, Valentin Mbenzo-Abokome, Bila-Isia Inogwabini, Jean-Jacques Muyembe-Tamfum, Eric Delaporte, and Martine PeetersComments to Author 
Author affiliations: University of Montpellier, Montpellier, France (S. Ahuka-Mundeke, A. Ayouba, F. Liegeois, A. Esteban, E. Delaporte, M. Peeters); Institut National de Recherche Biomédicales, Kinshasa, Democratic Republic of Congo (S. Ahuka-Mundeke, P. Mbala-Kingebeni, O. Lunguya-Metila, J.-J. Muyembe-Tamfum); Cliniques Universitaires de Kinshasa, Kinshasa (S. Ahuka-Mundeke, P. Mbala-Kingebeni, O. Lunguya-Metila, J.-J. Muyembe-Tamfum); Zone de Santé de Kole, Sankuru, Kasai Oriental, Democratic Republic of Congo (D. Demba, G. Bilulu); World Wildlife Fund For Nature, Kinshasa (V. Mbenzo-Abokome, B-I. Inogwabini)

Main Article

Table 3

Primers used to amplify simian immunodeficiency virus from dried blood spot samples

Primer Sequences, 5′ → 3′* Region targeted Estimated amplicon size, bp References
DR1 TRCAYACAGGRGCWGAYGA pol
800 (8,22)
DR2 AIADRTCATCCATRTAYTG
DR4 GGIATWCCICAYCCDGCAGG 200
DR5
GGIGAYCCYTTCCAYCCYTGHGG
polis4† CCAGCNCACAAAGGNATAGGAGG pol
800 (8,22)
polOR† ACBACYGCNCCTTCHCCTTTC
polis2† TGGCARATRGAYTGYACNCAYNTRGAA 400
uni2†
CCCCTATTCCTCCCCTTCTTTTAAAA
polis4† CCAGCNCACAAAGGNATAGGAGG pol
800 (8,22)
polOR† ACBACYGCNCCTTCHCCTTTC
polis4† CCAGCNCACAAAGGNATAGGAGG 650
uni2†
CCCCTATTCCTCCCCTTCTTTTAAAA
CNMF1 TATCCYTCCYTGTCATCYCTCTTT pol
2,750 (23)
POLor2 ACBACWGCTCCTTCWCCTTTCCA
CNMF2 AATGGAGAATGYTMATAGATTTCAG 2,050
CNMR
CCCCYATTCCTCCCTTTTTTTTA
SPBS GGCGCCCGAACAGGGACTTG gag-pol
2,500 (23)
2500P1 CCTCCTATGTTCCCCTATTTCTCTG
CNM.G1 CGAGGCACTCGGCGATGCTGA 2,200
2500P2
GGAACTGAGAAGGCTGTGTAAGGC
2500L1 CTATCCCCAAACGCATCCGC env-gag
2,000 (23)
CNM.G1rev TCAGCATCGCCGAGTGCCTCG
2500L2 AGAAAAGGGAGGACTGGAAGGGAT 800
SPBSrev
CAAGTCCCTGTTCGGGCGCC
CNMenvF1 TGTGTSAAAYTRACHCCNATGTGTGT env
2,480 (23)
CNMenvR1 AACATNNCYTCYAGTCCTCYCTTTTYT
CNMenvF2 TCCTTYAAYCAGACYACAGARTTYAGRGA 2,140
CNMenvR1
GGGATAGCCANGAATTNTCNCCAT
wrcpolF1 TAGGGACAGAAAGTATAGTAATHTGG pol
1,100 (24)
wrcpolR1 GCCATWGCYAA TGCTGTTTC
wrcpolF2 AGAGACAGTAAGGAAGGGAAAGCAGG 650
wrcpolR2
GTTCWATTCCTAACCACCAGCADA
wrcenvF1 TGGC AGTGGGACAAAAATATAAAC env 750 (24)
wrcenvR1 CTGGCAGTCCCTCTTCCA AGTT GT
wrcenvF2 TGATAGGGMTGGCTCCTGGTGATG 550
wrcenvR2 AATCCCCATTTYAACCAGTTCCA

*R = A or G; M = A or C; W = A or T; S = G or C; Y = C or T; B = C, G, or T; H = A, C, or T; and N = A, C, G, or T.
†Primers that amplifie simian immunodeficiency virus from dried blood spot samples in this study.

Main Article

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO