Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 18, Number 1—January 2012

Research

Invasive Meningococcal Capsular Group Y Disease, England and Wales, 2007–2009

Shamez N. LadhaniComments to Author , Jay Lucidarme, Lynne S. Newbold, Stephen J. Gray, Anthony D. Carr, Jamie Findlow, Mary E. Ramsay, Edward B. Kaczmarski, and Raymond Borrow
Author affiliations: Health Protection Agency, London, UK (S.N. Ladhani, M.E. Ramsay); Health Protection Agency, Manchester, UK (J. Lucidarme, L.S. Newbold, S.J. Gray, A.D. Carr, J. Findlow, E.B. Kaczmarski, R. Borrow); University of Manchester, Manchester (R. Borrow)

Main Article

Table 1

Primers used for genotypic analysis of lpxL1 of meningococcal capsular group Y, England and Wales, 2007–2009*

PCR/sequence Primer identification no. Direction Sequence, 5′ → 3′ Reference
PCR/sequence lpxL1-F†‡§ Forward TGCAGGTCAAACAGGCGGTAGT (14)
PCR/sequence lpxL1-R†¶# Reverse TTCAT(A/G)GGTTTGCGGTATTTCTTCCA (14)
PCR lpxL1-rR4‡ Reverse TCCACTTGAAATCGCGGCTGTC NA
Sequence lpxL1-s1C# Forward GTTCGAGATGGCGGTGTAC NA
Sequence lpxL1-s2# Reverse GAATCGTTGCGTCCGAAATCCTG NA
Sequence lpxL1-rR3§ Reverse AATACAGGCTTTCGCCTGCG NA
Sequence lpxL1-Rnew§ Reverse GTCAGTAAAAATCGGGGCTGCC NA

*NA, not applicable.
†Default PCR primer.
‡Alternative PCR primer.
§Used for sequence analysis of alternative PCR products (14).
¶Degenerate base added for this study.
#Used for sequence analysis of default PCR products.

Main Article

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO