Volume 18, Number 1—January 2012
Research
Invasive Meningococcal Capsular Group Y Disease, England and Wales, 2007–2009
Shamez N. Ladhani
, Jay Lucidarme, Lynne S. Newbold, Stephen J. Gray, Anthony D. Carr, Jamie Findlow, Mary E. Ramsay, Edward B. Kaczmarski, and Raymond Borrow
, Jay Lucidarme, Lynne S. Newbold, Stephen J. Gray, Anthony D. Carr, Jamie Findlow, Mary E. Ramsay, Edward B. Kaczmarski, and Raymond BorrowTable 1
Primers used for genotypic analysis of lpxL1 of meningococcal capsular group Y, England and Wales, 2007–2009*
| PCR/sequence | Primer identification no. | Direction | Sequence, 5′ → 3′ | Reference |
|---|---|---|---|---|
| PCR/sequence | lpxL1-F†‡§ | Forward | TGCAGGTCAAACAGGCGGTAGT | (14) |
| PCR/sequence | lpxL1-R†¶# | Reverse | TTCAT(A/G)GGTTTGCGGTATTTCTTCCA | (14) |
| PCR | lpxL1-rR4‡ | Reverse | TCCACTTGAAATCGCGGCTGTC | NA |
| Sequence | lpxL1-s1C# | Forward | GTTCGAGATGGCGGTGTAC | NA |
| Sequence | lpxL1-s2# | Reverse | GAATCGTTGCGTCCGAAATCCTG | NA |
| Sequence | lpxL1-rR3§ | Reverse | AATACAGGCTTTCGCCTGCG | NA |
| Sequence | lpxL1-Rnew§ | Reverse | GTCAGTAAAAATCGGGGCTGCC | NA |
*NA, not applicable.
†Default PCR primer.
‡Alternative PCR primer.
§Used for sequence analysis of alternative PCR products (14).
¶Degenerate base added for this study.
#Used for sequence analysis of default PCR products.
