Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 18, Number 10—October 2012


WU and KI Polyomaviruses in Respiratory Samples from Allogeneic Hematopoietic Cell Transplant Recipients

Jane Kuypers1Comments to Author , Angela P. Campbell1, Katherine A. Guthrie, Nancy L. Wright, Janet A. Englund, Lawrence Corey, and Michael Boeckh
Author affiliations: University of Washington, Seattle, Washington, USA (J. Kuypers, A.P. Campbell, N.L. Wright, J.A. Englund, L. Corey, M. Boeckh); Fred Hutchinson Cancer Research Center, Seattle (J. Kuypers, A.P. Campbell, K.A. Guthrie, J.A. Englund, L. Corey, M. Boeckh); and Seattle Children’s Hospital, Seattle (A.P. Campbell, J.A. Englund)

Main Article

Table 1

Primers and probes used for detecting KIPyV, WUPyV, and 2 other viruses by real-time RT-PCR and PCR in HCT recipients*

Virus Target gene Amplicon size, bp Function Sequence/label, 5′→3′ PCR concentration, nmol/L
Influenza B Matrix 76 Forward primer CACAATTGCCTACCTGCTTTCA 250
Parainfluenza type 4 NP 94 Forward primer TGCCAAATCGGCAATAAACA 250

*KIPyV, KI polyomavirus; WUPyV, WU polyomavirus; RT-PCR, reverse transcription PCR; HCT, hematopoietic cell transplantation; VP, viral protein; NP, nucleoprotein.

Main Article

1These authors contributed equally to this article.

Top of Page The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO