Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link
Volume 18, Number 3—March 2012
Research

Pathogenic Potential to Humans of Bovine Escherichia coli O26, Scotland

Margo E. Chase-ToppingComments to Author , Tracy Rosser, Lesley J. Allison, Emily Courcier, Judith Evans, Iain J. McKendrick, Michael C. Pearce, Ian Handel, Alfredo Caprioli, Helge Karch, Mary F. Hanson, Kevin G.J. Pollock, Mary E. Locking, Mark E.J. Woolhouse, Louise Matthews, J. Chris Low, and David L. Gally
Author affiliations: University of Edinburgh, Edinburgh, UK (M.E. Chase-Topping, E. Courcier, M.C. Pearce, M.E.J. Woolhouse); The Roslin Institute and Royal (Dick) School of Veterinary Studies, Edinburgh (T. Rosser, I. Handel, D.L. Gally); Scottish E. coli O157/VTEC Reference Laboratory, Edinburgh (L.J. Allison, M.F. Hanson); Scottish Agricultural College, Edinburgh (J. Evans, M.C. Pearce, J.C. Low); Biomathematics and Statistics Scotland, Edinburgh (I.J. McKendrick); Istituto Superiore di Sanità, Rome, Italy (A. Caprioli); University of Münster, Münster, Germany (H. Karch); Health Protection Scotland, Glasgow, UK (K.G.J. Pollock, M.E. Locking); University of Glasgow Veterinary School, Glasgow (L. Matthews)

Main Article

Table 2

Primers and PCR conditions for Escherichia coli O26, Scotland

Primer name Primer sequence, 5′ → 3′ Target gene Annealing Amplicon size, bp Reference
stx1F
stx1R ATAAATCGCCATTCGTTGACTAC
AGAACGCCCACTGAGATCATC stx1 60°C,45 s 180 (24)
stx2F
stx2R GGCACTGTCTGAAACTGCTCC
TCGCCAGTTATCTGACATTCTG stx2 60°C,45 s 255 (24)
eaeAF
eaeAR GACCCGGCACAAGCATAAGC
CCACCTGCAGCAACAAGAGG eae 60°C,45 s 384 (24)
hlyAF
hlyAR GCATCATCAAGCGTACGTTCC
AATGAGCCAAGCTGGTTAAGCT hlyA 60°C,45 s 534 (24)
sepLF
sepLR GCTAAGCCTGGGATATCGC
ACAATCGATACCCGAGAAGG sepL 60°C,45 s 725 This study
univ tccP/tccp2-F
tccP-R GTAAAAACCAGCTCACCTTTTTC
TCACGAGCGCTTAGATGTATTAAT tccp
tccP2 64°C,60 s Variable (25)
espAF
espAR CCTTCTCGGGTATCGATTGTCG
CAGAGGGCGTCACTAATGAGTG espA 58°C,60 s 1012 This study
LEE1promF
LEE1promR CGAATGGTACGGTTATGCGGG
GCTCTCGCAGTCGCTTTGCTTCC LEE1 58°C,60 s 645 This study

Main Article

References
  1. Tarr  PI, Gordon  CA, Chandler  WL. Shiga toxin-producing Escherichia coli and haemolytic uraemic syndrome. Lancet. 2005;365:1073–86.PubMedGoogle Scholar
  2. European Centre for Disease Prevention and Control. Annual epidemiological report on communicable diseases in Europe 2010 [cited 2010 Nov 2]. http://www.ecdc.europa.eu/en/publications/publications/1011
  3. Scheutz  F, Møller Nielsen  E, Frimodt-Møller  J, Boisen  N, Morabito  S, Tozzoli  R, Characteristics of the enteroaggregative Shiga toxin/verotoxin–producing Escherichia coli O104:H4 strain causing the outbreak of haemolytic uraemic syndrome in Germany, May to June 2011. Euro Surveill. 2011;16:pii:19889.PubMedGoogle Scholar
  4. Centers for Disease Control and Prevention. Foodnet—Foodborne Active Surveillance Network [cited 2010 Nov 2]. http://www.cdc.gov/foodnet
  5. Frankel  G, Phillips  AD. Attaching effacing Escherichia coli and paradigms of Tir-triggered actin polymerization: getting off the pedestal. Cell Microbiol. 2008;10:549–56. DOIPubMedGoogle Scholar
  6. Tree  JJ, Wolfson  EB, Wang  D, Roe  AJ, Gally  DL. Controlling injection: regulation of type III secretion in enterohaemorrhagic Escherichia coli. Trends Microbiol. 2009;17:361–70. DOIPubMedGoogle Scholar
  7. Wong  ARC, Pearson  JS, Bright  MD, Munera  D, Robinson  KS, Lee  SF, Enteropathogenic and enterohaemorrhagic Escherichia coli: even more subversive elements. Mol Microbiol. 2011;80:1420–38. DOIPubMedGoogle Scholar
  8. Boerlin  P, McEwen  SA, Boerlin-Petzold  F, Wilson  JB, Johnson  RP, Gyles  CL. Association between virulence factors of Shiga toxin–producing Escherichia coli and disease in humans. J Clin Microbiol. 1999;37:497–503.PubMedGoogle Scholar
  9. Mellmann  A, Bielaszewska  M, Köck  R, Friedrich  AW, Fruth  A, Middendorf  B, Analysis of collection of hemolytic uremic syndrome-associated enterohemorrhagic Escherichia coli. Emerg Infect Dis. 2008;14:1287–90. DOIPubMedGoogle Scholar
  10. Käppeli  U, Hächler  H, Giezendanner  N, Beutin  L, Stephan  R. Human infections with non-O157 Shiga toxin–producing Escherichia coli, Switzerland, 2000–2009. Emerg Infect Dis. 2011;17:180–5.PubMedGoogle Scholar
  11. Tesh  VL, Burris  JA, Owens  JW, Gordon  VM, Wadolkowski  EA, Obrein  AD, Comparison of the relative toxicities of Shiga-like toxins type-I and type-II for mice. Infect Immun. 1993;61:3392–402.PubMedGoogle Scholar
  12. Siegler  RL, O’Brien  TG, Pysher  TJ, Tesh  VL, Denkers  ND, Taylor  FB. Response to Shiga toxin 1 and 2 in a baboon model of hemolytic uremic syndrome. Pediatr Nephrol. 2003;18:92–6.PubMedGoogle Scholar
  13. Caprioli  A, Tozzi  AE, Rizzoni  G, Karch  H. Non-O157 Shiga toxin-producing Escherichia coli infections in Europe. Emerg Infect Dis. 1997;3:578–9. DOIPubMedGoogle Scholar
  14. Zhang  WL, Bielaszewska  M, Liesegang  A, Tschäpe  H, Schmidt  H, Bitzan  M, Molecular characteristics and epidemiological significance of Shiga toxin–producing Escherichia coli O26 strains. J Clin Microbiol. 2000;38:2134–40.PubMedGoogle Scholar
  15. Geue  L, Klare  S, Schnick  C, Mintel  B, Meyer  K, Conraths  FJ. Analysis of the clonal relationship of serotype O26:H11 enterohemorrhagic Escherichia coli isolates from cattle. Appl Environ Microbiol. 2009;75:6947–53. DOIPubMedGoogle Scholar
  16. Hutchinson  JP, Cheney  TEA, Smith  RP, Lynch  K, Pritchard  GC. Verocytoxin-producing and attaching and effacing activity of Escherichia coli isolated from diseased farm livestock. Vet Rec. 2011;168:536. DOIPubMedGoogle Scholar
  17. Bettelheim  KA. Non-O157 Verotoxin-producing Escherichia coli: a problem, paradox and paradigm. Exp Biol Med (Maywood). 2003;228:333–44.PubMedGoogle Scholar
  18. Jenkins  C, Evans  J, Chart  H, Willshaw  GA, Frankel  G. Escherichia coli serogroup O26—a new look at an old adversary. J Appl Microbiol. 2008;104:14–25.PubMedGoogle Scholar
  19. McMaster  C, Roch  EA, Willshaw  GA, Doherty  A, Kinnear  W, Cheasty  T. Verocytotoxin-producing Escherichia coli serotype O26:H11 outbreak in an Irish creche. Eur J Clin Microbiol Infect Dis. 2001;20:430–2.PubMedGoogle Scholar
  20. Allerberger  F, Freidrich  AW, Grif  K, Dierich  MP, Dornbush  HJ, Mache  CJ, Hemolytic uremic syndrome associated with enterohemorrhagic Escherichia coli O26:H infection and consumption of unpasturized cow’s milk. Int J Infect Dis. 2003;7:42–5. DOIPubMedGoogle Scholar
  21. Pearce  MC, Evans  J, McKendrick  IJ, Smith  AW, Knight  HI, Mellor  DJ, Prevalence and virulence factors of Escherichia coli serogroups O26, O103, O111 and O145 shed by cattle in Scotland. Appl Environ Microbiol. 2006;72:653–9. DOIPubMedGoogle Scholar
  22. Evans  J, Knight  H, McKendrick  IJ, Stevenson  H, Varo Barbudo  A, Gunn  GJ, Prevalence of Escherichia coli O157:H7 and serogroups O26, O103, O111 and O145 in sheep presented for slaughter in Scotland. J Med Microbiol. 2011;60:653–60. DOIPubMedGoogle Scholar
  23. Chase-Topping  M, Gally  D, Low  C, Matthews  L, Woolhouse  M. Super-shedding and the link between human infection and livestock carriage of Escherichia coli O157. Nat Rev Microbiol. 2008;6:904–12. DOIPubMedGoogle Scholar
  24. Paton  AW, Paton  JC. Detection and characterization of Shiga toxigenic Escherichia coli by using multiplex PCR assays for stx1, stx2, eaeA, enterohemorrhagic E. coli hlyA, rfbO111 and rfbO157. J Clin Microbiol. 1998;36:598–602.PubMedGoogle Scholar
  25. Kozub-Witkowski  E, Krause  G, Frankel  G, Kramer  D, Appel  B, Beutin  L. Serotypes and virutypes of enteropathogenic and enterohaemorrhagic Escherichia coli strains from stool samples from children with diarrhea in Germany. J Appl Microbiol. 2008;104:403–10.PubMedGoogle Scholar
  26. Willshaw  GA, Smith  HR, Cheasty  T, Wall  PG, Rowe  B. Vero cytotoxin-producing Escherichia coli O157 outbreaks in England and Wales, 1995: phenotypic methods and genotypic subtyping. Emerg Infect Dis. 1997;3:561–5. DOIPubMedGoogle Scholar
  27. Wirth  T, Falush  D, Lan  R, Colles  F, Mensa  P, Wieler  LH, Sex and virulence in Escherichia coli: an evolutionary perspective. Mol Microbiol. 2006;60:1136–51. DOIPubMedGoogle Scholar
  28. Pearce  MC, Chase-Topping  ME, McKendrick  IJ, Mellor  DJ, Locking  ME, Allison  L, Temporal and spatial patterns of bovine Escherichia coli O157 prevalence and comparison of temporal changes in the patterns of phage types associated with bovine shedding and human E. coli O157 cases in Scotland between 1998–2000 and 2002–2004. BMC Microbiol. 2009;9:276. DOIPubMedGoogle Scholar
  29. Condon  J, Kelly  G, Bradshaw  B, Leonard  N. Estimation of infection prevalence from correlated binomial samples. Prev Vet Med. 2004;64:1–14. DOIPubMedGoogle Scholar
  30. Food Standard Agency. Comparison of human and cattle E. coli O26 isolates by pulsed field gel electrophoresis (PFGE) [cited 2010 Nov 10]. http://www.foodbase.org.uk/results.php?f_report_id=155
  31. Bonnet  E, Van de Peer  Y. zt: a software tool for simple and partial Mantel tests. J Stat Softw. 2002;7:1–12.
  32. McCune  B, Grace  JB. Analysis of ecological ecosystems. Glenden Beach (OR): MjM Software Design; 2002.
  33. Adler  D, Murdoch  D. rgl: 3D visualization device system (OpenGL). R package version 0.92.798 [cited 2012 Jan 18]. http://CRAN.R-project.org/package=rgl
  34. Bielaszewska  M, Prager  R, Kock  R, Mellmann  A, Zhang  W, Tschape  H, Shiga toxin gene loss and transfer in vitro and in vivo during enterohemorrhagic Escherichia coli O26 infection in humans. Appl Environ Microbiol. 2007;73:3144–50. DOIPubMedGoogle Scholar
  35. Mellmann  A, Bielaszewska  M, Zimmerhackl  LB, Prager  R, Harmsen  D, Tschäpe  H, Enterohemorrhagic Escherichia coli in human infection: in vivo evolution of a bacterial pathogen. Clin Infect Dis. 2005;41:785–92. DOIPubMedGoogle Scholar
  36. Kimmitt  PT, Harwood  CR, Barer  MR. Induction of type 2 Shiga toxin synthesis in Escherichia coli O157 by 4-quinolones. Lancet. 1999;353:1588–9. DOIPubMedGoogle Scholar
  37. Köhler  B, Karch  H, Schmidt  H. Antibacterials that are used as growth promoters in animal husbandry can affect the release of Shiga-toxin-2-converting bacteriophages and Shiga toxin 2 from Escherichia coli strains. Microbiology. 2000;146:1085–90.PubMedGoogle Scholar
  38. O’Reilly  KM, Denwood  MJ, Low  JC, Gally  DL, Evans  J, Gunn  GJ, The role of virulence determinants in the epidemiology and ecology of zoonotic E. coli. Appl Environ Microbiol. 2010;76:8110–6.PubMedGoogle Scholar
  39. Pollock  KG, Bhojani  S, Beattie  TJ, Allison  L, Hanson  M, Locking  ME, Emergence of highly virulent Escherichia coli O26, Scotland. Emerg Infect Dis. 2011;17:1777–9. DOIPubMedGoogle Scholar
  40. Bettelheim  KA. The non-O157 Shiga-toxigenic (Verocytotoxigenic) Escherichia coli; under-rated pathogens. Crit Rev Microbiol. 2007;33:67–87. DOIPubMedGoogle Scholar

Main Article

Page created: February 16, 2012
Page updated: February 16, 2012
Page reviewed: February 16, 2012
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external