Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 19, Number 12—December 2013

Research

Zoonotic Chlamydiaceae Species Associated with Trachoma, Nepal

Deborah DeanComments to Author , James Rothschild, Anke Ruettger, Ram Prasad Kandel, and Konrad Sachse
Author affiliations: Children's Hospital Oakland Research Institute, Oakland, California, USA (D. Dean, J. Rothschild); University of California, San Francisco, California, USA (D. Dean); University of California, Berkeley, California, USA (D. Dean); Friedrich-Loeffler-Institut, Jena, Germany (A. Ruettger, K. Sachse); Lumini Eye Hospital, Bhairahawa, Nepal (R.P. Kandel)

Main Article

Table 1

Oligonucleotide primers used for the ArrayTube, quantitative real-time –PCR, and PCR for subsequent sequencing

Gene
Primers
Primer sequence, 5′→ 3′
Gene
location
Base pair
Reference
23S rRNA* U23F-19 ATTGAMAGGCGAWGAAGGA (17)
23R-22 biotin-GCYTACTAAGATGTTTCAGTTC
Chlamydiaceae
16S rRNA† 16SrRNA-9 GCGAAGGCGCTTTTCTAATTTAT 734–756‡ 76 (6)
16SrRNA-10 CCAGGGTATCTAATCCTGTTTGCT 809–786‡
Chlamydia trachomatis ompA OmpA-9 TGCCGCTTTGAGTTCTGCTT 33–52§ 75 (6)
OmpA-10 GTCGATCATAAGGCTTGGTTCAG 108–86§
C. pneumoniae ompA Cpn ompAF1 ATAGACCTAACCCGGCCTACAATAAG 301–330 108 (6)
Cpn ompAR1 GTGAACCACTCTGCATCGTGTAA 353–333 53
C. psittaciompA CpsF GCAACTCCTACGGAGTCTTAA 260–279 93 (6)
CpsB GGCATCTTGTAAATGTTTCCCTAT 331–354
C. pecorumompA Cp-F GTTTTCGACAGAGTCCTCAA 208–227 118 This study
CpRT-R ATTCTAATTTGCTCTTCTGG 325–305
C. abortusompA CpaOMP1-F GCAACTGACACTAAGTCGGCTACA 763–786 82 (15)
CpaOMP1-R ACAAGCATGTTCAATCGATAAGAGA 845–821
C. suisompA Cs-F GGAGATTATGTTTTCGATCGC 195–216 122 This study
Cs-R TAAGCTGCATTACTCGTTGTTTCA 338–292
β-actin† β-actin-3 GGTGCATCTCTGCCTTACAGATC 412–434¶ 73 (6)
β-actin-4 ACAGCCTGGATAGCAACGTACAT 52–30#
C. trachomatis ompA** ompAF-1 GTGCCGCCAGAAAAAGAT −60–40§ 1542 (6)
ompAR-2 CCAGAAACACGGATAGTGTTATTA 55–31††
C. pneumoniae ompA** CPF1 TTACAAGCCTTGCCTGTAGGGA 70–91‡‡ 1098 (8)
CPB4 AGAATCTGGACTGACCAGATACGTGAG 1169–1142‡‡
C. psittaciompA** Cps-1 GTATTAAAAGTTGATGTGAATAA 217–239§§ 1022 (8)
Cps-B4 TTGATTAAGCGTGCTTCACCAGTGATT 1169–1143§§
C. suisompA** Cs-F GGAGATTATGTTTTCGATCGC 195–216 959 This study
Cs-R TAGAATCTGAATTGAGCGTTTACGTGA 1154–1128
C. pecorumompA** Cp-F GTTTTCGACAGAGTCCTCAA 208–227 966 This study
Cp-R GAATCTGAACTGACCAGATACGTGAG 1173–1148
16Sr RNA** 16SrRNA-F CAGTCGAGAATCTTTCGCAAT 362–382c 904 (6)
16SrRNA-R TACTGCCCATTGTAGCACGTGTGT 1265–1232c

*Primers used in ArrayTube (Alere Technologies, Jena, Germany).
†Primer pairs used for real-time PCR of ompA DNA and of cDNA from RNA for 16SrRNA for detecting Chlamydiaceae.
‡Primer location based on reference strain L2/434 16SrRNA sequence.
§Primer location based on reference strain L2/434 ompA sequence.
¶Primer location based on position within intron 3 of the human β-actin sequence.
#Primer location based on position within exon 3 of the human β-actin sequence.
**Primer pairs used for PCR.
‡‡Primer location based on intergenic region of reference strain L2/434 downstream of ompA sequence.
‡‡Primer location based on C. pneumoniae strain TW183 ompA.
§§Primer location based on C. psittaci avian type C strain ompA.

Main Article

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO