Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 19, Number 7—July 2013


Novel Bartonella Agent as Cause of Verruga Peruana

David L. BlazesComments to Author , Kristin Mullins, Bonnie L. Smoak, Ju Jiang, Enrique Canal, Nelson Solorzano, Eric Hall, Rina Meza, Ciro Maguina, Todd Myers, Allen L. Richards, and Larry Laughlin
Author affiliations: Uniformed Services University of the Health Sciences, Bethesda, Maryland, USA (D.L. Blazes, K. Mullins, B.L. Smoak, L. Laughlin); Walter Reed Army Institute of Research, Silver Spring, Maryland, USA (B.L. Smoak); Naval Medical Research Center, Silver Spring (J. Jiang, E. Hall, T. Myers, A.L. Richards); Naval Medical Research Unit 6, Lima, Peru (E. Canal, R. Meza); Hospital San Juan de Dios, Lima (N. Solorzano); Universidad Peruana Cayetano Heredia–Tropicales, Lima (C. Maguina)

Main Article


Primers used for PCR, nested PCR, and sequencing of novel Bartonella isolate from Peru, 2011–2012*

Gene Primer name Primer sequence, 5’ → 3’ Use Fragment length
rrs 16SU17F AGAGTTTGATCCTGGCTCAG PCR, nPCR, sequencing 1,424 bp

16S E. coli-518F
nPCR, sequencing

gltA BHCS 781p (F) GGGACCAGCTCATGGTGG PCR, sequencing 338 bp

BHCS 1137n (R)
PCR, sequencing


*nPCR, nested PCR.
gltA primers were previously described by Eremeeva et al. (4).

Main Article

Top of Page The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO