Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 19, Number 9—September 2013

Research

Use of Staged Molecular Analysis to Determine Causes of Unexplained Central Nervous System Infections

Chien-Chin HsuComments to Author , Rafal Tokarz, Thomas Briese, Hung-Chin Tsai, Phenix-Lan Quan, and W. Ian Lipkin
Author affiliations: Columbia University, New York, New York, USA (C.-C. Hsu, R. Tokarz, T. Briese, P.-L. Quan, W.I. Lipkin); Southern Taiwan University of Science and Technology, Tainan, Taiwan (C.-C. Hsu); Chi-Mei Medical Center, Tainan (C.-C. Hsu); National Yang-Ming University Kaohsiung, Taiwan (H.-C. Tsai); Kaohsiung Veterans General Hospital, Kaohsiung (H.-C. Tsai)

Main Article

Table 1

Primers for MassTag central nervous system infections panel, RNA pathogens

Pathogen Target gene Primer sequence, 5′↔3′* Mass code
Eastern equine encephalitis virus E1 Fwd: ACACTAAATTCACCCTAGTTCGAT
Rev: GTGTATAAAATTACTTAGGAGCAGCATTATG 383/650
Nipah/Hendra virus Phos Fwd: GGGGGAATGYCTAAGRATGATG
Rev: TCCGGTACATTCTCCTCCATG 519/566
Japanese encephalitis virus NS5 Fwd: TCAACCTAGGGAGCGGAACA
Rev: GGCTGAGCCAGTAGCCTTCA 582/698
Parechovirus 5UTR Fwd: ACACTAGTTGTAAGGCCCACGAA
Rev: GGTBTGGCCCACTAGACGTTTT 690/606
Powassan virus NS5 Fwd: CATCCGACCATGCACCTAGA
Rev: CCAAAGTGAGGATGTGTACCAAAG 622/375
La Crosse virus S Fwd: CTCAACCTTGCTGCAGTTAGGA
Rev: CCACCTGCCACTCTCCAAA 686/590
Lymphocytic choriomeningitis virus pol Fwd: CCACTYTTGTCTGCACTGTCTAT
Rev: CTTTTTGATGCGCAATGGAT
614/654
St. Louis encephalitis virus NS5 Fwd: CATTTGTTCAGCTGTCCCAGTC
Rev: CTCACCCTTCCCATGAATTGA 658/423
Enteroviruses 5UTR Fwd: TCCTCCGGCCCCTGAATGCGGCTAATCC
Rev: GAAACACGGWCACCAAAGTASTCG 495/702
West Nile virus DF3 Fwd: CCACCGGAAGTTGAGTAGACG
Rev: GCTTTGTTCACCCAGTCCTCCT 499/539
Western equine encephalitis virus E1 Fwd: ACATCGAGCCCACAAGCA
Rev: GCATAGAGCTGCAGACCAACAC 598/678
Venezuelan equine encephalitis virus E1 Fwd: CTACGCGCCACTCCCTATCA
Rev: TGGCAGGTGACGTACTCCAA 602/646
Rabies virus N Fwd: GGGTTYATAAAVCAGATWAATCTCAC
Rev: GAAGTGRATGAAATARGAGTGAGG 475/558
Influenza A virus M Fwd: CATGGAATGGCTAAAGACAAGACC
Rev: AAGTGCACCAGCAGAATAACTGAG 618/690

*Fwd, forward primer; Rev, reverse primer.

Main Article

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO