Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 19, Number 9—September 2013

Research

Use of Staged Molecular Analysis to Determine Causes of Unexplained Central Nervous System Infections

Chien-Chin HsuComments to Author , Rafal Tokarz, Thomas Briese, Hung-Chin Tsai, Phenix-Lan Quan, and W. Ian Lipkin
Author affiliations: Columbia University, New York, New York, USA (C.-C. Hsu, R. Tokarz, T. Briese, P.-L. Quan, W.I. Lipkin); Southern Taiwan University of Science and Technology, Tainan, Taiwan (C.-C. Hsu); Chi-Mei Medical Center, Tainan (C.-C. Hsu); National Yang-Ming University Kaohsiung, Taiwan (H.-C. Tsai); Kaohsiung Veterans General Hospital, Kaohsiung (H.-C. Tsai)

Main Article

Table 2

Primers for MassTag CNS infections panel: DNA pathogens

Pathogen Target gene Primer sequence, 5′→3* Mass code
Virus
Adenoviruses Hexon Fwd: CCCMTTYAACCACCACCG
Rev: ACATCCTTBCKGAAGTTCCA 503/630
Cytomegalovirus Pol Fwd: CATGCGCGAGTGTCAAGAC
Rev: ACTTTGAGYGCCATCTGTTCCT 610/626
Epstein-Barr virus EBER Fwd: AAACCTCAGGACCTACGCTGC
Rev: AGACACCGTCCTCACCAC 570/463
Varicella-zoster virus Gp 31 Fwd: CCGATTCTGGATTTTCGTTGTT
Rev: AAAGTCGATTTCCCCCCAAA 471/515
Human herpesvirus 6 U7 Fwd: AAAATTTCTCACGCCGGTATTC
Rev: CCTGCAGACCGTTCGTCAA 357/718
Human herpesvirus 1 Gp C1 Fwd: GATGCCGGTTTCGGAATTC
Rev: CCCATGGAGTAACGCCATATCT 706/666
Human herpesvirus 2 UL3 Fwd: GGTCCCCTCTGCGTTTACTA


Rev: TCGACTCTATGGGCGTCGTA
527/642
Bacterium
Haemophilus influenzae hgbC Fwd: CGCTGGAAAGAGAACAAGCAA
Rev: TTTCAGCTTGACGTAATCCATC 726/734
Streptococcus pneumoniae plysin Fwd: GACTCCTAAGGCTTGGGACAGAAAT
Rev: TTCATAAACCGTACGCCACCATTC 694/714
Neisseria meningitides ctrA Fwd: TTCTGATGCGCGTGGTGTGT
Rev: CGCATCAGCCATATTCACACGA 439/730
Leptospira interrogans flaB Fwd: GATCATGAAGCAGAGRGCGGATATG
Rev: CCATATCGGCGTCYCGAATTC 634/383
Mycobacterium tuberculosis pncA Fwd: ACGTCAGGCCCACGACATTGA


Rev: CCTGGGCAAGCTGAACCTCGAA
395/475
Parasite: Toxoplasma gondii B1 Fwd: GAAGAGATCCAGCAGATCTCGT


Rev: TGAGAGGAGGCAGCACAAG
548/562
Fungus
Candida albicans CaAG Fwd: ACCAGTAGGAGTACAACGAACAGGAA
Rev: ATTTCATTGAATATTGGTGTGGTTCA 602/670
Cryptococcus neoformans cap59 Fwd: GCGAGGCAGCACAAGTACTT
Rev: TTGTCTGGTCGTTGGAMCCGTT 650/638

*Fwd, forward primer; Rev, reverse primer.

Main Article

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO