Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link

Volume 12, Number 11—November 2006

Research

Humans as Reservoir for Enterotoxin Gene–carrying Clostridium perfringens Type A

Annamari Heikinheimo*Comments to Author , Miia Lindström*, Per Einar Granum†, and Hannu Korkeala*
Author affiliations: *University of Helsinki, Helsinki, Finland; †Norwegian School of Veterinary Science, Oslo, Norway

Main Article

Table 1

Primers and PCR protocols for determining the genotype and location of cpe*

Primer Sequence (5´ to 3´) Primer target Sequence ref, GenBank accession no. Ref Size cpe genotype cpe location
CPEmmF CAAGTCAAATTCTTAATCCT cpe (22), Y16009 (12) 1.2 kb IS1151-cpe Plasmid
1151 R CATGGCCGTCAACCTAAGAAG IS1151 (23), X60694
CPEmmF CAAGTCAAATTCTTAATCCT cpe (22), Y16009 (12) 2.4 kb IS1470-cpe Chromosome
1470mR TGAAAACCGTGAAGAATTTGG IS1470 (12), X71844
cpe4F TTAGAACAGTCCTTAGGTGATGGAG cpe (14), AF511071 (24) 1.6 kb IS1470-like-cpe Plasmid
IS1470-likeR1.6
CTTTGTGTACACAGCTTCGCCAATGTC
IS1470-like
(24), AF416450




*Ref, reference.

*Ref, reference.

Main Article

References
  1. Smedley  JG III, Fisher  DJ, Sayeed  S, Chakrabarti  G, McClane  BA. The enteric toxins of Clostridium perfringens. Rev Physiol Biochem Pharmacol. 2004;152:183204. DOIPubMedGoogle Scholar
  2. Adak  GK, Long  SM, O'Brien  SJ. Trends in indigenous foodborne disease and deaths, England and Wales: 1992 to 2000. Gut. 2002;51:83241. DOIPubMedGoogle Scholar
  3. Lukinmaa  S, Takkunen  E, Siitonen  A. Molecular epidemiology of Clostridium perfringens related to food-borne outbreaks of disease in Finland from 1984 to 1999. Appl Environ Microbiol. 2002;68:37449. DOIPubMedGoogle Scholar
  4. Mead  PS, Slutsker  L, Dietz  V, McCaig  LF, Bresee  JS, Shapiro  C, Food-related illness and death in the United States. Emerg Infect Dis. 1999;5:60725. DOIPubMedGoogle Scholar
  5. Abrahao  C, Carman  RJ, Hahn  H, Liesenfeld  O. Similar frequency of detection of Clostridium perfringens enterotoxin and Clostridium difficile toxins in patients with antibiotic-associated diarrhea. Eur J Clin Microbiol Infect Dis. 2001;20:6767.PubMedGoogle Scholar
  6. Asha  NJ, Wilcox  MH. Laboratory diagnosis of Clostridium perfringens antibiotic-associated diarrhoea. J Med Microbiol. 2002;51:8914.PubMedGoogle Scholar
  7. Borriello  SP, Larson  HE, Welch  AR, Barclay  F, Stringer  MF, Bartholomew  BA. Enterotoxigenic Clostridium perfringens: a possible cause of antibiotic-associated diarrhoea. Lancet. 1984;1:3057. DOIPubMedGoogle Scholar
  8. Brett  MM, Rodhouse  JC, Donovan  TJ, Tebbutt  GM, Hutchinson  DN. Detection of Clostridium perfringens and its enterotoxin in cases of sporadic diarrhoea. J Clin Pathol. 1992;45:60911. DOIPubMedGoogle Scholar
  9. Mpamugo  O, Donovan  T, Brett  MM. Enterotoxigenic Clostridium perfringens as a cause of sporadic cases of diarrhoea. J Med Microbiol. 1995;43:4425. DOIPubMedGoogle Scholar
  10. Collie  RE, McClane  BA. Evidence that the enterotoxin gene can be episomal in Clostridium perfringens isolates associated with non-food-borne human gastrointestinal diseases. J Clin Microbiol. 1998;36:306.PubMedGoogle Scholar
  11. Cornillot  E, Saint-Joanis  B, Daube  G, Katayama  S, Granum  PE, Canard  B, The enterotoxin gene (cpe) of Clostridium perfringens can be chromosomal or plasmid-borne. Mol Microbiol. 1995;15:63947. DOIPubMedGoogle Scholar
  12. Brynestad  S, Synstad  B, Granum  PE. The Clostridium perfringens enterotoxin gene is on a transposable element in type A human food poisoning strains. Microbiology. 1997;143:210915. DOIPubMedGoogle Scholar
  13. Brynestad  S, Granum  PE. Evidence that Tn5565, which includes the enterotoxin gene in Clostridium perfringens, can have a circular form which may be a transposition intermediate. FEMS Microbiol Lett. 1999;170:2816. DOIPubMedGoogle Scholar
  14. Miyamoto  K, Chakrabarti  G, Morino  Y, McClane  BA. Organization of the plasmid cpe locus in Clostridium perfringens type A isolates. Infect Immun. 2002;70:426172. DOIPubMedGoogle Scholar
  15. Sarker  MR, Shivers  RP, Sparks  SG, Juneja  VK, McClane  BA. Comparative experiments to examine the effects of heating on vegetative cells and spores of Clostridium perfringens isolates carrying plasmid genes versus chromosomal enterotoxin genes. Appl Environ Microbiol. 2000;66:323440. DOIPubMedGoogle Scholar
  16. Wen  Q, McClane  BA. Detection of enterotoxigenic Clostridium perfringens type A isolates in American retail foods. Appl Environ Microbiol. 2004;70:268591. DOIPubMedGoogle Scholar
  17. Sparks  SG, Carman  RJ, Sarker  MR, McClane  BA. Genotyping of enterotoxigenic Clostridium perfringens fecal isolates associated with antibiotic-associated diarrhea and food poisoning in North America. J Clin Microbiol. 2001;39:8838. DOIPubMedGoogle Scholar
  18. Brynestad  S, Sarker  MR, McClane  BA, Granum  PE, Rood  JI. Enterotoxin plasmid from Clostridium perfringens is conjugative. Infect Immun. 2001;69:34837. DOIPubMedGoogle Scholar
  19. Miwa  N, Nishina  T, Kubo  S, Fujikura  K. Nested polymerase chain reaction for detection of low levels of enterotoxigenic Clostridium perfringens in animal feces and meat. J Vet Med Sci. 1996;58:197203. DOIPubMedGoogle Scholar
  20. Heikinheimo  A, Lindström  M, Korkeala  H. Enumeration and isolation of cpe-positive Clostridium perfringens spores from feces. J Clin Microbiol. 2004;42:39927. DOIPubMedGoogle Scholar
  21. Heikinheimo  A, Korkeala  H. Multiplex PCR assay for toxinotyping Clostridium perfringens isolates obtained from Finnish broiler chickens. Lett Appl Microbiol. 2005;40:40711. DOIPubMedGoogle Scholar
  22. Brynestad  S. Genetic studies on Clostridium perfringens enterotoxin [doctoral thesis]. Oslo: Norwegian College of Veterinary Medicine; 1997.
  23. Daube  G, Simon  P, Kaeckenbeeck  A. IS1151, an IS-like element of Clostridium perfringens. Nucleic Acids Res. 1993;21:352. DOIPubMedGoogle Scholar
  24. Miyamoto  K, Wen  Q, McClane  BA. Multiplex PCR genotyping assay that distinguishes between isolates of Clostridium perfringens type A carrying a chromosomal enterotoxin gene (cpe) locus, a plasmid cpe locus with an IS1470-like sequence, or a plasmid cpe locus with an IS1151 sequence. J Clin Microbiol. 2004;42:15528. DOIPubMedGoogle Scholar
  25. Ridell  J, Bjorkroth  J, Eisgruber  H, Schalch  B, Stolle  A, Korkeala  H. Prevalence of the enterotoxin gene and clonality of Clostridium perfringens strains associated with food-poisoning outbreaks. J Food Prot. 1998;61:2403.PubMedGoogle Scholar
  26. Miwa  N, Masuda  T, Kwamura  A, Terai  K, Akiyama  M. Survival and growth of enterotoxin-positive and enterotoxin-negative Clostridium perfringens in laboratory media. Int J Food Microbiol. 2002;72:2338. DOIPubMedGoogle Scholar
  27. Sandvig  K, Olsnes  S. Entry of the toxic proteins abrin, modeccin, ricin, and diphtheria toxin into cells. II. Effect of pH, metabolic inhibitors, and ionophores and evidence for toxin penetration from endocytotic vesicles. J Biol Chem. 1982;257:750413.PubMedGoogle Scholar
  28. Katayama  S, Dupuy  B, Daube  G, China  B, Cole  ST. Genome mapping of Clostridium perfringens strains with I-ceuI shows many virulence genes to be plasmid-borne. Mol Gen Genet. 1996;251:7206. DOIPubMedGoogle Scholar
  29. McClane  BA. Clostridium perfringens. In: Doyle MP, Beuchat LR, Montville TJ, editors. Food microbiology: fundamentals and frontiers. Washington: ASM Press; 2001. p. 351–72.
  30. Li  J, McClane  BA. Further comparison of temperature effects on growth and survival of Clostridium perfringens type A isolates carrying a chromosomal or plasmid-borne enterotoxin gene. Appl Environ Microbiol. 2006;72:45618. DOIPubMedGoogle Scholar

Main Article

Page created: October 14, 2011
Page updated: October 14, 2011
Page reviewed: October 14, 2011
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external