Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link
Volume 17, Number 8—August 2011
Research

Enterovirus 68 among Children with Severe Acute Respiratory Infection, the Philippines

Tadatsugu Imamura, Naoko Fuji, Akira Suzuki, Raita Tamaki, Mariko Saito, Rapunzel Aniceto, Hazel Galang, Lydia Sombrero, Soccoro Lupisan, and Hitoshi OshitaniComments to Author 
Author affiliations: Author affiliations: Tohoku University Graduate School of Medicine, Sendai, Japan (T. Imamura, N. Fuji, A. Suzuki, H. Oshitani); Tohoku-Research Institute for Tropical Medicine Collaborating Research Center on Emerging and Reemerging Diseases, Muntinlupa City, the Philippines (R. Tamaki, M. Saito, R. Aniceto); Eastern Visayas Regional Medical Center, Tacloban City, the Philippines (R. Aniceto); Research Institute for Tropical Medicine, Muntinlupa City (H. Galang, L. Sombrero, S. Lupisan)

Main Article

Table 1

Primers used for detection and analysis of EV68, the Phillipines*

Primer (reference) Primer sequence, 5′ → 3′ Location (location no.)†
DK001 (11) CAAGCACTTCTGTTTCCC 5′ NTR (164–168)
DK004 (12) CACGGACACCCAAAGTAGT 5′ NTR (483–501)
484 (5) GGRTCYCAYTACAGGATGT VP1 (2197–2215)
222 (5) CICCIGGIGGIAYRWACAT VP1 (2933–2951)
EV68-VP1F ACCATTTACATGCAGCAGAGG VP1 (2393–2413)
EV68-VP1R GACAAGAACTTTTTCAAATGGACAA VP1 (2683–2707)

*EV, enterovirus; NTR, nontranslated region; VP, viral protein; F, forward; R, reverse.
†Location numbers correspond to the genome of EV68 Fermon strain (GenBank accession no. AY426531).

Main Article

References
  1. Mirkovic  RR, Kono  R, Yin-Murphy  M, Sohier  R, Schmidt  NJ, Melnick  JL. Enterovirus type 70: the etiologic agent of pandemic acute haemorrhagic conjunctivitis. Bull World Health Organ. 1973;49:341–6.PubMedGoogle Scholar
  2. Junttila  N, Leveque  N, Kabue  JP, Cartet  G, Mushiya  F, Muyembe-Tamfum  JJ, New enteroviruses, EV-93 and EV-94, associated with acute flaccid paralysis in the Democratic Republic of the Congo. J Med Virol. 2007;79:393–400. DOIPubMedGoogle Scholar
  3. Smura  TP, Junttila  N, Blomqvist  S, Norder  H, Kaijalainen  S, Paananen  A, Enterovirus 94, a proposed new serotype in human enterovirus species D. J Gen Virol. 2007;88:849–58. DOIPubMedGoogle Scholar
  4. Schieble  JH, Fox  VL, Lennette  EH. A probable new human picornavirus associated with respiratory diseases. Am J Epidemiol. 1967;85:297–310.PubMedGoogle Scholar
  5. Oberste  MS, Maher  K, Schnurr  D, Flemister  MR, Lovchik  JC, Peters  H, Enterovirus 68 is associated with respiratory illness and shares biological features with both the enteroviruses and the rhinoviruses. J Gen Virol. 2004;85:2577–84. DOIPubMedGoogle Scholar
  6. Wang  Z, Malanoski  AP, Lin  B, Long  NC, Leski  TA, Blaney  KM, Broad spectrum respiratory pathogen analysis of throat swabs from military recruits reveals interference between rhinoviruses and adenoviruses. Microb Ecol. 2010;59:623–34. DOIPubMedGoogle Scholar
  7. Khetsuriani  N, Lamonte-Fowlkes  A, Oberst  S, Pallansch  MA. Enterovirus surveillance—United States, 1970–2005. MMWR Surveill Summ. 2006;55:1–20.PubMedGoogle Scholar
  8. Blomqvist  S, Savolainen  C, Raman  L, Roivainen  M, Hovi  T. Human rhinovirus 87 and enterovirus 68 represent a unique serotype with rhinovirus and enterovirus features. J Clin Microbiol. 2002;40:4218–23. DOIPubMedGoogle Scholar
  9. Ishiko  H, Miura  R, Shimada  Y, Hayashi  A, Nakajima  H, Yamazaki  S, Human rhinovirus 87 identified as human enterovirus 68 by VP4-based molecular diagnosis. Intervirology. 2002;45:136–41. DOIPubMedGoogle Scholar
  10. World Health Organization Program for Control of Acute Respiratory Infections. Management of young children with an acute respiratory infection. Geneva: The Program; 1990.
  11. Kiang  D, Yagi  S, Kantardjieff  KA, Kim  EJ, Louie  JK, Schnurr  DP. Molecular characterization of a variant rhinovirus from an outbreak associated with uncommonly high mortality. J Clin Virol. 2007;38:227–37. DOIPubMedGoogle Scholar
  12. Kiang  D, Kalra  I, Yagi  S, Louie  JK, Boushey  H, Boothby  J, Assay for 5′ noncoding region analysis of all human rhinovirus prototype strains. J Clin Microbiol. 2008;46:3736–45. DOIPubMedGoogle Scholar
  13. Oberste  M, Schnurr  D, Maher  K, al-Busaidy  S, Pallansch  M. Molecular identification of new picornaviruses and characterization of a proposed enterovirus 73 serotype. J Gen Virol. 2001;82:409–16.PubMedGoogle Scholar
  14. Norder  H, Bjerregaard  L, Magnius  LO. Homotypic echoviruses share aminoterminal VP1 sequence homology applicable for typing. J Med Virol. 2001;63:35–44. DOIPubMedGoogle Scholar
  15. Oberste  MS, Maher  K, Kilpatrick  DR, Pallansch  MA. Molecular evolution of the human enteroviruses: correlation of serotype with VP1 sequence and application to picornavirus classification. J Virol. 1999;73:1941–8.PubMedGoogle Scholar
  16. Santti  J, Hyypia  T, Kinnunen  L, Salminen  M. Evidence of recombination among enteroviruses. J Virol. 1999;73:8741–9.PubMedGoogle Scholar
  17. Savolainen-Kopra  C, Blomqvist  S, Smura  T, Roivainen  M, Hovi  T, Kiang  D, 5′ noncoding region alone does not unequivocally determine genetic type of human rhinovirus strains. J Clin Microbiol. 2009;47:1278–80. DOIPubMedGoogle Scholar
  18. Thoelen  I, Moes  E, Lemey  P, Mostmans  S, Wollants  E, Lindberg  AM, Analysis of the serotype and genotype correlation of VP1 and the 5′ noncoding region in an epidemiological survey of the human enterovirus B species. J Clin Microbiol. 2004;42:963–71. DOIPubMedGoogle Scholar
  19. Papadopoulos  NG, Bates  PJ, Bardin  PG, Papi  A, Leir  SH, Fraenkel  DJ, Rhinoviruses infect the lower airways. J Infect Dis. 2000;181:1875–84. DOIPubMedGoogle Scholar
  20. Cheung  D, Dick  EC, Timmers  MC, de Klerk  EP, Spaan  WJ, Sterk  PJ. Rhinovirus inhalation causes long-lasting excessive airway narrowing in response to methacholine in asthmatic subjects in vivo. Am J Respir Crit Care Med. 1995;152:1490–6.PubMedGoogle Scholar
  21. Fraenkel  DJ, Bardin  PG, Sanderson  G, Lampe  F, Johnston  SL, Holgate  ST. Lower airways inflammation during rhinovirus colds in normal and in asthmatic subjects. Am J Respir Crit Care Med. 1995;151:879–86.PubMedGoogle Scholar
  22. Grünberg  K, Timmers  MC, de Klerk  EP, Dick  EC, Sterk  PJ. Experimental rhinovirus 16 infection causes variable airway obstruction in subjects with atopic asthma. Am J Respir Crit Care Med. 1999;160:1375–80.PubMedGoogle Scholar
  23. Johnston  SL, Pattemore  PK, Sanderson  G, Smith  S, Lampe  F, Josephs  L, Community study of role of viral infections in exacerbations of asthma in 9–11 year old children. BMJ. 1995;310:1225–9.PubMedGoogle Scholar
  24. Rajaratnam  JK, Marcus  JR, Flaxman  AD, Wang  H, Levin-Rector  A, Dwyer  L, Neonatal, postneonatal, childhood, and under-5 mortality for 187 countries, 1970–2010: a systematic analysis of progress towards Millennium Development Goal 4. Lancet. 2010;375:1988–2008. DOIPubMedGoogle Scholar
  25. Monto  AS. Acute respiratory infection in children of developing countries: challenge of the 1990s. Rev Infect Dis. 1989;11:498–505. DOIPubMedGoogle Scholar

Main Article

Page created: August 15, 2011
Page updated: August 15, 2011
Page reviewed: August 15, 2011
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external