Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link
Volume 10, Number 9—September 2004
Dispatch

Typing of Borrelia Relapsing Fever Group Strains

Jonas Bunikis*Comments to Author , Jean I. Tsao†‡1, Ulf Garpmo§1, Johan Berglund§, Durland Fish†, and Alan G. Barbour*
Author affiliations: *University of California—Irvine, Irvine, California, USA; †Yale University School of Medicine, New Haven, Connecticut, USA; ‡Michigan State University, East Lansing, Michigan, USA; §Kalmar County Hospital, Kalmar, Sweden; 1These two authors contributed equally to the study.

Main Article

Table

Descriptive statistics for IGSa and p66 loci of three Borrelia species

Species Locus No. samples No. variants Aligned characters
 π b
Base pairs No. gapped Polymorphisms (%)
Borrelia miyamotoi s.l. IGS 33 4 474 15c 40 (8.4) 0.058
p66 d 19 3 617 9 38 (6.2) 0.042
B. lonestari IGS 20 3 412 1 14 (3.4) 0.023
p66 e 7 3 346 0 5 (1.4) 0.010
B. hermsii IGS 9 4 665 2 20 (3.0) 0.015
p66 e 5 3 516 3 8 (1.6) 0.010

a IGS, 16S-23S rRNA gene intergenic spacer region.
b π, mean nucleotide diversity at each aligned position.
c Excludes an 81-bp indel.
d Partial p66 genes were amplified by nested PCR with outer forward and reverse primers of 5′GATTTTTCTATATTTGGACACAT and 5′AATTTAATCAGATTGTTTAGCTCTA and inner primers of 5′GACACATATCTAAAAAAGCAAACAC and 5′CTAATCCGGTTTTTACGTATATGC and following conditions: 40 cycles of 94°C for 60 s, 55°C for 120 s, and 74°C for 120 s. GenBank accession numbers for p66 genotypes are the following: B. miyamotoi s.l. type 1 (AY363722), type 2 (AY363723), type 3 (AY363724); B. lonestari type 1 (AY363689), type 2 (AY363690), type 3 (AY363691); B. hermsii type 1 (AF016408), type 2 (AF228028), and type 4 (AF116905).
e Analysis of B. lonestari and B. hermsii p66 fragments was limited to 346 of 605 bp and 516 of 608 bp, respectively, which corresponded to the shortest sequences available for all types of the individual species.

Main Article

Page created: March 30, 2011
Page updated: March 30, 2011
Page reviewed: March 30, 2011
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external