Volume 11, Number 12—December 2005
Research
Pandemic Strain of Foot-and-Mouth Disease Virus Serotype O
Table
Oligonucleotide primers used for RT-PCR and cycle sequencing of FMDV strains*
Primer | Primer sequence (5´ → 3´) | Sense | Location on FMDV genome |
Use | |
---|---|---|---|---|---|
Gene | Position† | ||||
ARS4 | ACCAACCTCCTTGATGTGGCT | + | 1C | 2349–2369 | RT-PCR |
O-1C244F | GCAGCAAAACACATGTCAAACACCTT | + | 1C | 2469–2494 | RT-PCR |
O-1C272F | TBGCRGGNCTYGCCCAGTACTAC | + | 1C | 2497–2519 | RT-PCR |
O-1C283F | GCCCAGTACTACACACAGTACAG | + | 1C | 2508–2530 | RT-PCR |
NK61 | GACATGTCCTCCTGCATCTG | – | 2B | 3630–3649 | RT-PCR |
NK72 | GAAGGGCCCAGGGTTGGACTC | – | 2A/2B | 3558–3578 | Sequencing |
O-1C499F | TACGCGTACACCGCGTC | + | 1C | 2724–2740 | Sequencing |
O-1C583F | GACGGYGAYGCICTGGTCGT | + | 1C | 2808–2827 | Sequencing |
A-1C612F | TAGCGCCGGCAAAGACTTTGA | + | 1C | 2834–2854 | Sequencing |
O-1D296F | ACAACACCACCAACCCAAC | + | 1D | 3181–3199 | Sequencing |
O-1D628R | GTTGGGTTGGTGGTGTTGT | – | 1D | 3181–3199 | Sequencing |
*RT-PCR, reverse transcription–polymerase chain reaction; FMDV, food-and-mouth disease virus.
†Position on the genome of O1/Kaufbeuren/FRG/66 (EMBL/GenBank accession no. X00871).
Page created: February 02, 2012
Page updated: February 02, 2012
Page reviewed: February 02, 2012
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.