Volume 12, Number 11—November 2006
Letter
Rickettsia parkeri in Uruguay
Table
Primer pairs used for amplification of rickettsial genes
| Primer pairs | Genes and primers | Primer sequences (5´→3´) | Fragment size (nucleotides) | Reference |
|---|---|---|---|---|
| gltA | ||||
| 1 | CS-78 | GCAAGTATCGGTGAGGATGTAAT | 401 | (7) |
| CS-323 | GCTTCCTTAAAATTCAATAAATCAGGAT | (7) | ||
| 2 | CS-239 | GCTCTTCTCATCCTATGGCTATTAT | 834 | (7) |
| CS-1069 | CAGGGTCTTCGTGCATTTCTT | (7) | ||
| ompB | ||||
| 3 | 120-M59 | CCGCAGGGTTGGTAACTGC | 862 | (8) |
| 120–807 | CCTTTTAGATTACCGCCTAA | (8) | ||
| ompA | ||||
| 4 | Rr190.70p | ATGGCGAATATTTCTCCAAAA | 530 | (9) |
| Rr190.602n | AGTGCAGCATTCGCTCCCCCT | (9) |
References
- Conti-Diaz IA, Rubio I, Somma Moreira RE, Perez Bormida G. Rickettsioses cutaneo ganglionar por Rickettsia conorii en el Uruguay. Rev Inst Med Trop Sao Paulo. 1990;32:313–8. DOIPubMedGoogle Scholar
- Diaz IA. Rickettsioses caused by Rickettsia conorii in Uruguay. Ann N Y Acad Sci. 2003;990:264–6. DOIPubMedGoogle Scholar
- Parola P, Paddock CD, Raoult D. Tick-born rickettsioses around the world: emerging diseases challenging old concepts. Clin Microbiol Rev. 2005;18:719–56. DOIPubMedGoogle Scholar
- Venzal JM, Guglielmone AA, Estrada Peña A, Cabrera PA, Castro O. Ticks (Ixodida: Ixodidae) parasitising humans in Uruguay. Ann Trop Med Parasitol. 2003;97:769–72. DOIPubMedGoogle Scholar
- Venzal JM, Portillo A, Estrada-Peña A, Castro O, Cabrera PA, Oteo JA. Rickettsia parkeri in Amblyomma triste from Uruguay. Emerg Infect Dis. 2004;10:1493–5.PubMedGoogle Scholar
- Horta MC, Pinter A, Cortez A, Soares RM, Gennari SM, Schumaker TTS, Rickettsia felis (Rickettsiales: Rickettsiaceae) in Ctenocephalides felis felis (Siphonaptera: Pulicidae) in the State of São Paulo, Brazil. Arq Bras Med Vet Zoot. 2005;57:321–5. DOIGoogle Scholar
- Labruna MB, Whitworth T, Horta MC, Bouyer DH, McBride JW, Pinter A, Rickettsia species infecting Amblyomma cooperi ticks from an area in the State of São Paulo, Brazil, where Brazilian spotted fever is endemic. J Clin Microbiol. 2004;42:90–8. DOIPubMedGoogle Scholar
- Roux V, Raoult D. Phylogenetic analysis of members of the genus Rickettsia using the gene encoding the outer membrane protein rOmpB (ompB). Int J Syst Evol Microbiol. 2000;50:1449–55. DOIPubMedGoogle Scholar
- Regnery RL, Spruill CL, Plikaytis BD. Genotypic identification of rickettsiae and estimation of intraspecies sequence divergence for portions of two rickettsial genes. J Bacteriol. 1991;173:1576–89.PubMedGoogle Scholar
- Guglielmone AA, Estrada-Peña A, Keirans JE, Robbins RG. Ticks (Acari: Ixodida) of the Neotropical Zoogeographic Region. International Consortium on Ticks and Tick-borne Diseases, Atalanta, Houten, The Netherlands; 2003.
Page created: October 14, 2011
Page updated: October 14, 2011
Page reviewed: October 14, 2011
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.