Volume 14, Number 3—March 2008
Research
Chikungunya Fever in Travelers Returning to Europe from the Indian Ocean Region, 2006
Table 2
Real-time reverse transcription–PCR (RT-PCR) assay results for chikungunya virus (CHIKV)
| Oligonucleotide name | Purpose* | Sequence and label, 5′ →3′ | Position (GenBank accession no.) |
|---|---|---|---|
| ChikSI | Forward primer, general CHIKV assay | TGATCCCGACTCAACCATCCT | 241-261 (AF369024) |
| ChikSII | Forward primer, adapted assay for Indian Ocean strain | CCGACTCAACCATCCTGGAT | 246-265 (DQ443544) |
| ChikAsI | Reverse primer, general CHIKV assay | GGCAAACGCAGTGGTACTTCCT | 323-302 (AF369024) |
| ChikAsII | Reverse primer, adapted assay for Indian Ocean strain | GGCAGACGCAGTGGTACTTCCT | 323-302 (DQ443544) |
| ChikP | Detection probe, CHIKV | FAM-TCCGACATCATCCTCCTTGCTGGC-BHQ1 | 300-277 (AF369024) |
| ICP | Detection probe, internal control | DYXL-ATCGTTCGTTGAGCGATTAGCAG-BHQ2 | Not applicable |
*All oligonucleotides were used in the following assay: 25-µL reaction volume, 3 µL of RNA extract (Viral RNA Mini Kit, QIAGEN, Hilden, Germany), QIAGEN OneStep RT-PCR Kit, 600 nmol/L each primer, 200 nmol/L each probe. Cycling at 50°C for 30 min, 95°C for 15 min, 45 cycles each at 95°C for 15 s and 58°C for 30 s, LightCycler (Roche, Mannheim, Germany).
Page created: July 07, 2010
Page updated: July 07, 2010
Page reviewed: July 07, 2010
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.