Volume 14, Number 3—March 2008
Research
Chikungunya Fever in Travelers Returning to Europe from the Indian Ocean Region, 2006
Table 2
Real-time reverse transcription–PCR (RT-PCR) assay results for chikungunya virus (CHIKV)
Oligonucleotide name | Purpose* | Sequence and label, 5′ →3′ | Position (GenBank accession no.) |
---|---|---|---|
ChikSI | Forward primer, general CHIKV assay | TGATCCCGACTCAACCATCCT | 241-261 (AF369024) |
ChikSII | Forward primer, adapted assay for Indian Ocean strain | CCGACTCAACCATCCTGGAT | 246-265 (DQ443544) |
ChikAsI | Reverse primer, general CHIKV assay | GGCAAACGCAGTGGTACTTCCT | 323-302 (AF369024) |
ChikAsII | Reverse primer, adapted assay for Indian Ocean strain | GGCAGACGCAGTGGTACTTCCT | 323-302 (DQ443544) |
ChikP | Detection probe, CHIKV | FAM-TCCGACATCATCCTCCTTGCTGGC-BHQ1 | 300-277 (AF369024) |
ICP | Detection probe, internal control | DYXL-ATCGTTCGTTGAGCGATTAGCAG-BHQ2 | Not applicable |
*All oligonucleotides were used in the following assay: 25-µL reaction volume, 3 µL of RNA extract (Viral RNA Mini Kit, QIAGEN, Hilden, Germany), QIAGEN OneStep RT-PCR Kit, 600 nmol/L each primer, 200 nmol/L each probe. Cycling at 50°C for 30 min, 95°C for 15 min, 45 cycles each at 95°C for 15 s and 58°C for 30 s, LightCycler (Roche, Mannheim, Germany).