Volume 15, Number 4—April 2009
Research
Hantavirus Pulmonary Syndrome, Central Plateau, Southeastern, and Southern Brazil
Table 1
Primers used for reverse transcription–PCR of hantaviruses, Brazil, 1998–2007
Gene*/primer | Sequence (5′ → 3′) | Nucleotide annealing site |
---|---|---|
N/SAHN-C | CAAAACCAGTTGATCAACAGGG | 213–236 of hantavirus small RNA segment |
N/SAHN-S | GATGAATCATCCTTGAACCTTAT | 454–477 of hantavirus small RNA segment |
G1/HANGn-C | GGGCAGTAAGTGCTGAAAC | 1301–1320 of hantavirus medium RNA segment |
G1/HANGn-S | ACATTTAGCAGTTTGCCATGGG | 1602–1625 of hantavirus medium RNA segment |
*N, nucleocapsid; G1, glycoprotein 1.
Page created: December 10, 2010
Page updated: December 10, 2010
Page reviewed: December 10, 2010
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.