Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link

Volume 17, Number 4—April 2011

Research

Complete Sequence and Molecular Epidemiology of IncK Epidemic Plasmid Encoding blaCTX-M-14

Jennifer L. Cottell, Mark A. Webber, Nick G. Coldham, Dafydd L. Taylor, Anna M. Cerdeño-Tárraga, Heidi Hauser, Nicholas R. Thomson, Martin J. Woodward, and Laura J.V. PiddockComments to Author 
Author affiliations: Author affiliations: The University of Birmingham, Birmingham, UK (J.L. Cottell, M.A. Webber, D.L. Taylor, L.J.V. Piddock); Veterinary Laboratories Agency, New Haw, Surrey, UK (N.G. Coldham, M.J. Woodward); European Nucleotide Archive–European Bioinformatics Institute, Hinxton, UK (A.M. Cerdeño-Tárraga); The Wellcome Trust Sanger Institute, Hinxton (H. Hauser, N.R. Thomson)

Main Article

Table 2

Primers used for detecting pCT-like regions in plasmids from Escherichia coli, United Kingdom, Europe, Australia, and Asia, 2006–2009

Primer Sequence, 5′ → 3′ Target DNA sequence Size, bp pCT binding site Reference
CTX-M-G9 (F) ATGGTGACAAAGAGAGTGCAAC blaCTX-M group 9 variants 876 70259–70280 (25)
CTX-M-G9 (R) TTACAGCCCTTCGGCGATG blaCTX-M group 9 variants 876 69405–69423 (25)
ISEcp1A (F) GCAGGTCTTTTTCTGCTCC Insertion sequence ISEcp1 527 71728–71746 (27)
ISEcp1B (R) ATTTCCGGAGCACCGTTTGC Insertion sequence ISEcp1 527/1,037† 71220–71239 (27)
B3A (F) AACGGCACAATGACGCTGGC Insertion sequence IS903 887 69913–69932 (24)
IS903 (R) TGTAATCCGGCAGCGTA Insertion sequence IS903 887 69045–69061 (24)
Pseudo (R) AACATTCGGCCGTTCACAGC Region downstream of blaCTX-M-14 1,636 68644–68663 This study
traK (F) GGTACCGGCATCGCACAGAA Region upstream of ISEcp1 1,037 72238–72257 This study
Sigma (F) ACAGCGTCTTCTCGTATCCA pCT putative sigma factor 1,289 48590–48609 This study
Sigma (R) GTTCTTCCAGCTGACGTAAC pCT putative sigma factor 1,289 47320–47339 This study
pCT rci (F) AAGGTCATCTGCAGGAGT pCT shufflon recombinase 945 78364–78381 This study
pCT rci (R) GTGTGCGCAGCAACAATA pCT shufflon recombinase 945 77436–77453 This study
pilN (F) GACAGGCAGAGAACACCAGA pCT pilN outer membrane protein 627 88267–88286 This study
pilN (R) ATGCTGTTCCACCTGATGAG pCT pilN outer membrane protein 627 87659–87678 This study
nikB (F) CGTGCMTGCCGTGARCTT IncI complex nikB relaxase gene 290 33077–33094 This study
nikB (R) TCCCAGCCATCCWTCACC IncI complex nikB relaxase gene 290 33350–33367 This study
pCT008 (F) CATTGTATCTATCTTGTGGG pCT pCT008-pCT009 region 428 3665–3684 This study
pCT009 (R) GCATTCCAGAAGATGACGTT pCT pCT008-pCT009 region 428 4074–4093 This study

*pCT, IncK plasmid; CTX-M, cefotaximase-modifying; F, forward primer; R, reverse primer.
†Primer ISEcp1B can be paired with primer ISEcp1A (527 bp) or with primer traK (1,037 bp).

Main Article

References
  1. Johnson  TJ, Wannemuehler  YM, Johnson  SJ, Logue  CM, White  DG, Doetkott  C, Plasmid replicon typing of commensal and pathogenic Escherichia coli isolates. Appl Environ Microbiol. 2007;73:1976–83. DOIPubMedGoogle Scholar
  2. Miró  E, Mirelis  B, Navarro  F, Rivera  A, Mesa  RJ, Roig  MC, Surveillance of extended-spectrum β-lactamases from clinical samples and faecal carriers in Barcelona, Spain. J Antimicrob Chemother. 2005;56:1152–5. DOIPubMedGoogle Scholar
  3. Perez  F, Endimiani  A, Hujer  KM, Bonomo  RA. The continuing challenge of ESBLs. Curr Opin Pharmacol. 2007;7:459–69. DOIPubMedGoogle Scholar
  4. Woodford  N, Ward  ME, Kaufmann  ME, Turton  J, Fagan  EJ, James  D, Community and hospital spread of Escherichia coli producing CTX-M extended-spectrum β-lactamases in the UK. J Antimicrob Chemother. 2004;54:735–43. DOIPubMedGoogle Scholar
  5. Lau  SH, Kaufmann  ME, Livermore  DM, Woodford  N, Willshaw  GA, Cheasty  T, UK epidemic Escherichia coli strains A–E, with CTX-M-15 β-lactamase, all belong to the international O25:H4–ST131 clone. J Antimicrob Chemother. 2008;62:1241–4. DOIPubMedGoogle Scholar
  6. Nicolas-Chanoine  MH, Blanco  J, Leflon-Guibout  V, Demarty  R, Alonso  MP, Caniça  MM, Intercontinental emergence of Escherichia coli clone O25:H4–ST131 producing CTX-M-15. J Antimicrob Chemother. 2008;61:273–81. DOIPubMedGoogle Scholar
  7. Cantón  R, Novais  A, Valverde  A, Machado  E, Peixe  L, Baquero  F, Prevalence and spread of extended-spectrum β-lactamase–producing Enterobacteriaceae in Europe. Clin Microbiol Infect. 2008;14(Suppl 1):144–53. DOIPubMedGoogle Scholar
  8. Sheldon  T. Dutch doctors warn that the overuse of antibiotics in farming is increasing resistance. BMJ. 2010;341:5677. DOIGoogle Scholar
  9. Hunter  PA, Dawson  S, French  GL, Goossens  H, Hawkey  PM, Kuijper  EJ, Antimicrobial-resistant pathogens in animals and man: prescribing, practices and policies. J Antimicrob Chemother. 2010;65(Suppl 1):i3–17. DOIPubMedGoogle Scholar
  10. Hawkey  PM, Jones  AM. The changing epidemiology of resistance. J Antimicrob Chemother. 2009;64(Suppl 1):i3–10. DOIPubMedGoogle Scholar
  11. Valverde  A, Canton  R, Garcillan-Barcia  MP, Novais  A, Galán  JC, Alvarado  A, Spread of blaCTX-M-14 is driven mainly by IncK plasmids disseminated among Escherichia coli phylogroups A, B1, and D in Spain. Antimicrob Agents Chemother. 2009;53:5204–12. DOIPubMedGoogle Scholar
  12. Liu  W, Chen  L, Li  H, Duan  H, Zhang  Y, Liang  X, Novel CTX-M β-lactamase genotype distribution and spread into multiple species of Enterobacteriaceae in Changsha, southern China. J Antimicrob Chemother. 2009;63:895–900. DOIPubMedGoogle Scholar
  13. Diestra  K, Juan  C, Curiao  T, Moyá  B, Miró  E, Oteo  J, Characterization of plasmids encoding blaESBL and surrounding genes in Spanish clinical isolates of Escherichia coli and Klebsiella pneumoniae. J Antimicrob Chemother. 2009;63:60–6. DOIPubMedGoogle Scholar
  14. Carattoli  A. Resistance plasmid families in Enterobacteriaceae. Antimicrob Agents Chemother. 2009;53:2227–38. DOIPubMedGoogle Scholar
  15. Teale  CJ, Barker  L, Foster  A, Liebana  E, Batchelor  M, Livermore  DM, Extended-spectrum β-lactamase detected in E.coli recovered from calves in Wales. Vet Rec. 2005;156:186–7.PubMedGoogle Scholar
  16. Liebana  E, Batchelor  M, Hopkins  KL, Clifton-Hadley  FA, Teale  CJ, Foster  A, Longitudinal farm study of extended-spectrum β-lactamase–mediated resistance. J Clin Microbiol. 2006;44:1630–4. DOIPubMedGoogle Scholar
  17. Cullik  A, Pfeifer  Y, Prager  R, von Baum  H, Witte  W. A novel IS26 structure surrounds blaCTX-M genes in different plasmids from German clinical isolates of Escherichia coli. J Med Microbiol. 2010;59:580–7. DOIPubMedGoogle Scholar
  18. Vinué  L, Lantero  M, Saenz  Y, Somalo  S, de Diego  I, Pérez  F, Characterization of extended-spectrum β-lactamases and integrons in Escherichia coli isolates in a Spanish hospital. J Med Microbiol. 2008;57:916–20. DOIPubMedGoogle Scholar
  19. Chanawong  A, M'Zali  FH, Heritage  J, Xiong  JH, Hawkey  PM. Three cefotaximases, CTX-M-9, CTX-M-13, and CTX-M-14, among Enterobacteriaceae in the People’s Republic of China. Antimicrob Agents Chemother. 2002;46:630–7. DOIPubMedGoogle Scholar
  20. Zong  Z, Partridge  SR, Thomas  L, Iredell  JR. Dominance of blaCTX-M within an Australian extended-spectrum β-lactamase gene pool. Antimicrob Agents Chemother. 2008;52:4198–202. DOIPubMedGoogle Scholar
  21. Birmboim  HC, Doly  J. A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res. 1979;7:1513–23. DOIPubMedGoogle Scholar
  22. Smith  CA, Thomas  CM. Deletion mapping of kil and kor functions in the trfA and trfB regions of broad host range plasmid RK2. Mol Gen Genet. 1983;190:245–54. DOIPubMedGoogle Scholar
  23. Chain  PSG, Grafham  DV, Fulton  RS, Fitzgerald  MG, Hostetler  J, Muzny  D, Genomics: genome project standards in a new era of sequencing. Science. 2009;326:236–7. DOIPubMedGoogle Scholar
  24. Navarro  F, Mesa  RJ, Miro  E, Gomez  L, Mirelis  B, Coll  P. Evidence for convergent evolution of CTX-M-14 ESBL in Escherichia coli and its prevalence. FEMS Microbiol Lett. 2007;273:120–3. DOIPubMedGoogle Scholar
  25. Batchelor  M, Hopkins  K, Threlfall  EJ, Clifton-Hadley  FA, Stallwood  AD, Davies  RH, blaCTX-M genes in clinical Salmonella isolates recovered from humans in England and Wales from 1992 to 2003. Antimicrob Agents Chemother. 2005;49:1319–22. DOIPubMedGoogle Scholar
  26. Poirel  L, Decousser  JW, Nordmann  P. Insertion sequence ISEcp1B is involved in expression and mobilization of a blaCTX-M β-lactamase gene. Antimicrob Agents Chemother. 2003;47:2938–45. DOIPubMedGoogle Scholar
  27. Karim  A, Poirel  L, Nagarajan  S, Nordmann  P. Plasmid-mediated extended-spectrum β-lactamase (CTX-M-3 like) from India and gene association with insertion sequence ISEcp1. FEMS Microbiol Lett. 2001;201:237–41.PubMedGoogle Scholar
  28. Garcillán-Barcia  MP, Francia  MV, de la Cruz  F. The diversity of conjugative relaxases and its application in plasmid classification. FEMS Microbiol Rev. 2009;33:657–87. DOIPubMedGoogle Scholar
  29. Tamura  K, Dudley  J, Nei  M, Kumar  S. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol. 2007;24:1596–9. DOIPubMedGoogle Scholar
  30. Saitou  N, Nei  M. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol. 1987;4:406–25.PubMedGoogle Scholar
  31. Eckert  C, Gautier  V, Arlet  G. DNA sequence analysis of the genetic environment of various blaCTX-M genes. J Antimicrob Chemother. 2006;57:14–23. DOIPubMedGoogle Scholar
  32. Woodford  N, Carattoli  A, Karisik  E, Underwood  A, Ellington  MJ, Livermore  DM. Complete nucleotide sequences of plasmids pEK204, pEK499 and pEK516, encoding CTX-M enzymes in three major Escherichia coli lineages from the United Kingdom, all belonging to the international O25:H4–ST131 clone. Antimicrob Agents Chemother. 2009;53:4472–82. DOIPubMedGoogle Scholar
  33. Shen  P, Jiang  Y, Zhou  Z, Zhang  J, Yu  Y, Li  L. Complete nucleotide sequence of pKP96, a 67 850 bp multiresistance plasmid encoding qnrA1, aac(6′)-Ib-cr and blaCTX-M-24 from Klebsiella pneumoniae. J Antimicrob Chemother. 2008;62:1252–6. DOIPubMedGoogle Scholar
  34. Dudley  EG, Abe  C, Ghigo  JM, Latour-Lambert  P, Hormazabal  JC, Nataro  JP. An IncI1 plasmid contributes to the adherence of the atypical enteroaggregative Escherichia coli strain C1096 to cultured cells and abiotic surfaces. Infect Immun. 2006;74:2102–14. DOIPubMedGoogle Scholar
  35. Bradley  DE. Characteristics and function of thick and thin conjugative pili determined by transfer-derepressed plasmids of incompatibility groups I1, I2, I5, B, K and Z. J Gen Microbiol. 1984;130:1489–502.PubMedGoogle Scholar
  36. Leyton  DL, Sloan  J, Hill  RE, Doughty  S, Hartland  EL. Transfer region of pO113 from enterohemorrhagic Escherichia coli: similarity with R64 and identification of a novel plasmid-encoded autotransporter, EpeA. Infect Immun. 2003;71:6307–19. DOIPubMedGoogle Scholar
  37. Blanc  V, Cortes  P, Mesa  RJ, Miro  E, Navarro  F, Llagostera  M. Characterisation of plasmids encoding extended-spectrum β-lactamase and CMY-2 in Escherichia coli isolated from animal farms. Int J Antimicrob Agents. 2008;31:76–8. DOIPubMedGoogle Scholar

Main Article

Page created: July 25, 2011
Page updated: July 25, 2011
Page reviewed: July 25, 2011
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external