Volume 17, Number 6—June 2011
Dispatch
Multidrug-Resistant Acinetobacter baumannii Harboring OXA-24 Carbapenemase, Spain
Table 2
Primer | Gene | Sequence, 5′ → 3′ |
---|---|---|
TonB-Forw | TonB-dependent receptor | GGACTGGTGATAAAGCACTAT |
TonB-Rev | TonB-dependent receptor | GCCGCATAGAGTTATCACATC |
Septicolysin-Forw | Septicolysin | CACCATCTTGTACCAATACATTT |
Septicolysin-Rev | Septicolysin | GAAATTAGCAGAAGCTCTCTTAC |
rpoB-Forw | RNA polymerase subunit B | CAGCCGCGAYCAGGTTGACTACA |
rpoB-Rev | RNA polymerase subunit B | GACGCACCGCAGGATACCACCTG |
gyrB-Forw | DNA gyrase subunit B | AAGTGAGGTAAAACCAGCGGTA |
gyrB-Rev | DNA gyrase subunit B | AATCTTGCCTGCAATTGATTTT |
*Forw, forward; rev, reverse.
1These authors contributed equally to this article.
Page created: August 03, 2011
Page updated: August 03, 2011
Page reviewed: August 03, 2011
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.