Skip directly to page options Skip directly to A-Z link
Volume 17, Number 8—August 2011
Research

Novel Human Reovirus Isolated from Children with Acute Necrotizing Encephalopathy

Louise A. Ouattara, Francis Barin, Marie Anne Barthez, Bertrand Bonnaud, Philippe Roingeard, Alain Goudeau, Pierre Castelnau, Guy Vernet, Gláucia Paranhos-BaccalàComments to Author , and Florence Komurian-Pradel
Author affiliations: Author affiliations: Fondation Mérieux, Lyon, France (L.A. Ouattara, G. Vernet, G. Paranhos-Baccalà, F. Komurian-Pradel); Centre Hospitalier Universitaire Bretonneau (F. Barin, P. Roingeard, A. Goudeau); Institut National de la Santé et de la Recherche Médicale U966, Tours, France (F. Barin, P. Roingeard, A. Goudeau); Centre Hospitalier Universitaire, Clocheville, Tours (M.A. Barthez, P. Castelnau); bioMérieux SA, Marcy l’Etoile, France (B. Bonnaud)

Main Article

Table 1

Primers used for amplification of MRV2TOU05, a novel human type 2 reovirus, and complete sequencing and reovirus detection*

Primer Sequence, 5′ → 3′ Position (strain) RT-PCR product size, bp GenBank accession no.
For genome amplification of MRV2Tou05
L1 forward GCTACACGTTCCACGACAAT 1–20 (SC-A) 3,852 GU196306
L1 reverse TGAGTTGACGCACCACGACCCA 3852–3831 (SC-A)
L2 forward ATGGCGAACGTTTGGGGAGT 13–32 (SC-A) 3,903 GU196307
L2 reverse GATGAATTAGGCACGCTCACG 3915–3895 (SC-A)
L3 forward TAATCGTCAGGATGAAGCGGA 3–23 (SC-A) 3,897 GU196308
L3 reverse TGAATCGGCCCAACTAGCAT 3899–3880 (SC-A)
M1 forward ATGGCTTACATCGCAGTTCCT 14–34 (SC-A) 2,278 GU196309
M1 reverse CGTAGTCTTAGCCCGCCCC 2291–2273 (SC-A)
M2 forward TAATCTGCTGACCGTCACTC 3–22 (SC-A) 2,195 GU196310
M2 reverse GTGCCTGCATCCCTTAACC 2197–2179 (SC-A)
M3 forward CGTGGTCATGGCTTCATTC 12–30 (SC-A) 2,230 GU196311
M3 reverse GATGAATAGGGGTCGGGAA 2241–2223 (SC-A)
S2 forward CTATTCGCTGGTCAGTTATG 2–21 (SC-A) 1,330 GU196312
S2 reverse GATGAATGTGTGGTCAGTCG 1331–1312 (SC-A)
S3 forward TAAAGTCACGCCTGTTGTCG 3–22 (SC-A) 1,178 GU196313
S3 reverse ACCACCAAGACATCGGCAC 1180–1162 (SC-A)
S4 forward GTTGTCGCAATGGAGGTGTG 24–43 (SC-A) 1,158 GU196314
S4 reverse TCCCACGTCACACCAGGTT 1181–1163 (SC-A)
S1 forward CCGATGTCCGAACTTCAACA 1–17 (MRV2Tou05) 1,423
GU196315
S1 reverse
ATGAATTGCCGTCGTGCCG
1423–1405 (MRV2Tou05)
For reovirus detection test
L3-2 reverse GGATGATTCTGCCATGAGCT 705–686 (BYD1) 696 ND
L3-1 forward CAGGATGAAGCGGATTCCAA 10–29 (T3D, T1L, T2J, SC-A, BYD1) ND
L3-5 reverse CCAACACGCGCAGGATGTTT 522–503 (T3D, BYD1, T1L) 512 ND
L3-1 forward CAGGATGAAGCGGATTCCAA 10–29 (T3D, T1L, T2J, SC-A, BYD1) ND

*RT-PCR, reverse transcription PCR; L, large segment; M, medium segment; S, small segment; ND, not determined.

Main Article

Page created: August 24, 2011
Page updated: August 24, 2011
Page reviewed: August 24, 2011
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external