Volume 17, Number 8—August 2011
Research
Novel Human Reovirus Isolated from Children with Acute Necrotizing Encephalopathy
Louise A. Ouattara, Francis Barin, Marie Anne Barthez, Bertrand Bonnaud, Philippe Roingeard, Alain Goudeau, Pierre Castelnau, Guy Vernet, Gláucia Paranhos-Baccalà
, and Florence Komurian-Pradel
, and Florence Komurian-Pradel
Table 1
Primers used for amplification of MRV2TOU05, a novel human type 2 reovirus, and complete sequencing and reovirus detection*
| Primer | Sequence, 5′ → 3′ | Position (strain) | RT-PCR product size, bp | GenBank accession no. |
|---|---|---|---|---|
| For genome amplification of MRV2Tou05 | ||||
| L1 forward | GCTACACGTTCCACGACAAT | 1–20 (SC-A) | 3,852 | GU196306 |
| L1 reverse | TGAGTTGACGCACCACGACCCA | 3852–3831 (SC-A) | ||
| L2 forward | ATGGCGAACGTTTGGGGAGT | 13–32 (SC-A) | 3,903 | GU196307 |
| L2 reverse | GATGAATTAGGCACGCTCACG | 3915–3895 (SC-A) | ||
| L3 forward | TAATCGTCAGGATGAAGCGGA | 3–23 (SC-A) | 3,897 | GU196308 |
| L3 reverse | TGAATCGGCCCAACTAGCAT | 3899–3880 (SC-A) | ||
| M1 forward | ATGGCTTACATCGCAGTTCCT | 14–34 (SC-A) | 2,278 | GU196309 |
| M1 reverse | CGTAGTCTTAGCCCGCCCC | 2291–2273 (SC-A) | ||
| M2 forward | TAATCTGCTGACCGTCACTC | 3–22 (SC-A) | 2,195 | GU196310 |
| M2 reverse | GTGCCTGCATCCCTTAACC | 2197–2179 (SC-A) | ||
| M3 forward | CGTGGTCATGGCTTCATTC | 12–30 (SC-A) | 2,230 | GU196311 |
| M3 reverse | GATGAATAGGGGTCGGGAA | 2241–2223 (SC-A) | ||
| S2 forward | CTATTCGCTGGTCAGTTATG | 2–21 (SC-A) | 1,330 | GU196312 |
| S2 reverse | GATGAATGTGTGGTCAGTCG | 1331–1312 (SC-A) | ||
| S3 forward | TAAAGTCACGCCTGTTGTCG | 3–22 (SC-A) | 1,178 | GU196313 |
| S3 reverse | ACCACCAAGACATCGGCAC | 1180–1162 (SC-A) | ||
| S4 forward | GTTGTCGCAATGGAGGTGTG | 24–43 (SC-A) | 1,158 | GU196314 |
| S4 reverse | TCCCACGTCACACCAGGTT | 1181–1163 (SC-A) | ||
| S1 forward | CCGATGTCCGAACTTCAACA | 1–17 (MRV2Tou05) | 1,423 |
GU196315 |
| S1 reverse |
ATGAATTGCCGTCGTGCCG |
1423–1405 (MRV2Tou05) |
||
| For reovirus detection test | ||||
| L3-2 reverse | GGATGATTCTGCCATGAGCT | 705–686 (BYD1) | 696 | ND |
| L3-1 forward | CAGGATGAAGCGGATTCCAA | 10–29 (T3D, T1L, T2J, SC-A, BYD1) | ND | |
| L3-5 reverse | CCAACACGCGCAGGATGTTT | 522–503 (T3D, BYD1, T1L) | 512 | ND |
| L3-1 forward | CAGGATGAAGCGGATTCCAA | 10–29 (T3D, T1L, T2J, SC-A, BYD1) | ND | |
*RT-PCR, reverse transcription PCR; L, large segment; M, medium segment; S, small segment; ND, not determined.
Page created: August 24, 2011
Page updated: August 24, 2011
Page reviewed: August 24, 2011
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.