Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link

Volume 18, Number 12—December 2012

Research

Reservoir Competence of Wildlife Host Species for Babesia microti

Michelle H. HershComments to Author , Michael Tibbetts, Mia Strauss, Richard S. Ostfeld, and Felicia Keesing
Author affiliations: Bard College, Annandale-on-Hudson, New York, USA (M.H. Hersh, M. Tibbetts, M. Strauss, F. Keesing); and Cary Institute of Ecosystem Studies, Millbrook, New York, USA (M.H. Hersh, R.S. Ostfeld)

Main Article

Table 3

Sequences of Babesia microti 18S rDNA from newly molted nymphal Ixodes scapularis ticks fed on vertebrate hosts aligned with sequences from known zoonotic isolates and raccoon isolates from GenBank, southeastern New York, USA, 2008–2010*

Species Sequence, 5′ → 3′
Didelphis virginiana A20030_21 AAGGCAATAACAGGTCTGTGATGCCCTTAGATGTCCTGGGCTGCACGCGCGCTACACTGATGTATTCAACGAGTTTTTTCCTTGGC
Procyon lotor 506_10 AAGGCAATAACAGGTCTGTGATGCCCTTAGATGTCCTGGGCTGCACGCGCGCTACACTGATGTATTCAACGAGTTTTTTCCTTGGC
Babesia microti raccoon isolate, USA (AY144701) AAGGCAATAACAGGTCTGTGATGCCCTTAGATGTCCTGGGCTGCACGCGCGCTACACTGATGTATTCAACGAGTTTTTTCCTTGGC
B. microti raccoon isolate, Japan (AB197940) AAGGCAATAACAGGTCTGTGATGCCCTTAGATGTCCTGGGCTGCACGCGCGCTACACTGATGTATTCAACGAGTTTTTTCCTTGGC
Blarina brevicauda BB3_10 AAGGCAATAACAGGTCTGTGATGCCCTTAGATGTCCTGGGCTGCACGCGCGCTACACTGATGCATTCAACGAG-TTTTTCCTTGGC
Catharus fuscescens, 2341–01870_17 AAGGCAATAACAGGTCTGTGATGCCCTTAGATGTCCTGGGCTGCACGCGCGCTACACTGATGCATTCAACGAG-TTTTTCCTTGGC
Hylocichla mustelina 1951–10576_14 AAGGCAATAACAGGTCTGTGATGCCCTTAGATGTCCTGGGCTGCACGCGCGCTACACTGATGCATTCAACGAG-TTTTTCCTTGGC
Peromyscus leucopus A20003_10 AAGGCAATAACAGGTCTGTGATGCCCTTAGATGTCCTGGGCTGCACGCGCGCTACACTGATGCATTCAACGAG-TTTTTCCTTGGC
Sciurus carolinensis E412_14 AAGGCAATAACAGGTCTGTGATGCCCTTAGATGTCCTGGGCTGCACGCGCGCTACACTGATGCATTCAACGAG-TTTTTCCTTGGC
Tamias striatus H1037_11 AAGGCAATAACAGGTCTGTGATGCCCTTAGATGTCCTGGGCTGCACGCGCGCTACACTGATGCATTCAACGAG-TTTTTCCTTGGC
B. microti GI strain (AF231348) AAGGCAATAACAGGTCTGTGATGCCCTTAGATGTCCTGGGCTGCACGCGCGCTACACTGATGCATTCAACGAG-TTTTTCCTTGGC
B. microti Jena/Germany isolate (EF413181) AAGGCAATAACAGGTCTGTGATGCCCTTAGATGTCCTGGGCTGCACGCGCGCTACACTGATGCATTCAACGAG-TTTTTCCTTGGC
B. microti Kobe isolate (AB032434) AAGGCAATAACAGGTCTGTGATGCCCTTAGATGTCCTGGGCTGCACGCGCGCTACACTGATGCATTCAACGAG--TTTTCCTTGGC

*Sequences for zoonotic isolates were obtained from Gray et al. (4). The 85–86-bp sequence is the region of 18S rDNA between primers smbaJF and smbaKR. Consistent 2-bp differences between ticks collected from different host species are indicated in boldface. The empty row separates sequences with basepair differences. Accessions nos. for GenBank sequences are indicated in parentheses after isolate names. GI, American isolate.

Main Article

References
  1. Homer  MJ, Aguilar-Delfin  I, Telford  SR, Krause  PJ, Persing  DH. Babesiosis. Clin Microbiol Rev. 2000;13:451–69. DOIPubMedGoogle Scholar
  2. Kogut  SJ, Thill  CD, Prusinski  MA, Lee  JH, Backenson  PB, Coleman  JL, Babesia microti, upstate New York. Emerg Infect Dis. 2005;11:476–8. DOIPubMedGoogle Scholar
  3. Joseph  JT, Roy  SS, Shams  N, Visintainer  P, Nadelman  RB, Hosur  S, Babesiosis in Lower Hudson Valley, New York, USA. Emerg Infect Dis. 2011;17:843–7. DOIPubMedGoogle Scholar
  4. Gray  J, Zintl  A, Hildebrandt  A, Hunfeld  K-P, Weiss  L. Zoonotic babesiosis: overview of the disease and novel aspects of pathogen identity. Ticks Tick Borne Dis. 2010;1:3–10. DOIPubMedGoogle Scholar
  5. Gray  J, von Stedingk  LV, Gürtelschmid  M, Granström  M. Transmission studies of Babesia microti in Ixodes ricinus ticks and gerbils. J Clin Microbiol. 2002;40:1259–63. DOIPubMedGoogle Scholar
  6. Uilenberg  G. Babesia: a historical overview. Vet Parasitol. 2006;138:3–10. DOIPubMedGoogle Scholar
  7. Oliveira  MR, Kreier  JP. Transmission of Babesia microti using various species of ticks as vectors. J Parasitol. 1979;65:816–7. DOIPubMedGoogle Scholar
  8. Tokarz  R, Jain  K, Bennett  A, Briese  T, Lipkin  WI. Assessment of polymicrobial infections in ticks in New York State. Vector Borne Zoonotic Dis. 2010;10:217–21. DOIPubMedGoogle Scholar
  9. Adelson  ME, Rao  R-VS, Tilton  RC, Cabets  K, Eskow  E, Fein  L, Prevalence of Borrelia burgdorferi, Bartonella spp., Babesia microti, and Anaplasma phagocytophila in Ixodes scapularis ticks collected in northern New Jersey. J Clin Microbiol. 2004;42:2799–801. DOIPubMedGoogle Scholar
  10. Holman  MS, Caporale  DA, Goldberg  J, Lacombe  E, Lubelczyk  C, Rand  PW, Anaplasma phagocytophilum, Babesia microti, and Borrelia burgdorferi in Ixodes scapularis, southern coastal Maine. Emerg Infect Dis. 2004;10:744–6. DOIPubMedGoogle Scholar
  11. Spielman  A, Levine  JF, Wilson  ML. Vectorial capacity of North American Ixodes ticks. Yale J Biol Med. 1984;57:507–13.PubMedGoogle Scholar
  12. Walk  ST, Xu  G, Stull  JW, Rich  SM. Correlation between tick density and pathogen endemicity, New Hampshire. Emerg Infect Dis. 2009;15:585–7. DOIPubMedGoogle Scholar
  13. Ostfeld  RS. Lyme disease: the ecology of a complex system. New York: Oxford University Press; 2011.
  14. Piesman  J, Mather  TN, Dammin  GJ, Telford  SR, Lastavica  CC, Spielman  A. Seasonal variation of transmission risk of Lyme disease and human babesiosis. Am J Epidemiol. 1987;126:1187–9.PubMedGoogle Scholar
  15. Leiby  DA. Transfusion-transmitted Babesia spp.: bull’s-eye on Babesia microti. Clin Microbiol Rev. 2011;24:14–28. DOIPubMedGoogle Scholar
  16. Healy  GR, Spielman  A, Gleason  N. Human babesiosis: reservoir in infection on Nantucket Island. Science. 1976;192:479–80. DOIPubMedGoogle Scholar
  17. Spielman  A, Etkind  P, Piesman  J, Ruebush  TK II, Juranek  DD, Jacobs  MS. Reservoir hosts of human babesiosis on Nantucket Island. Am J Trop Med Hyg. 1981;30:560–5.PubMedGoogle Scholar
  18. Telford  SR, Spielman  A. Reservoir competence of white-footed mice for Babesia microti. J Med Entomol. 1993;30:223–7.PubMedGoogle Scholar
  19. Beck  R, Vojta  L, Curkovic  S, Mrljak  V, Margaletic  J, Habrun  B. Molecular survey of Babesia microti in wild rodents in central Croatia. Vector Borne Zoonotic Dis. 2011;11:81–3. DOIPubMedGoogle Scholar
  20. Duh  D, Petrovec  M, Trilar  T, Avsic-Zupanc  T. The molecular evidence of Babesia microti infection in small mammals collected in Slovenia. Parasitology. 2003;126:113–7. DOIPubMedGoogle Scholar
  21. Rar  VA, Epikhina  TI, Livanova  NN, Panov  VV. Genetic diversity of Babesia in Ixodes persulcatus and small mammals from North Ural and West Siberia, Russia. Parasitology. 2011;138:175–82. DOIPubMedGoogle Scholar
  22. Saito-Ito  A, Kasahara  M, Kasai  M, Dantrakool  A, Kawai  A, Fujita  H, Survey of Babesia microti infection in field rodents in Japan: records of the Kobe-type in new foci and findings of a new type related to the Otsu-type. Microbiol Immunol. 2007;51:15–24.PubMedGoogle Scholar
  23. Zamoto  A, Tsuji  M, Wei  Q, Cho  SH, Shin  EH, Kim  TS, Epizootiologic survey for Babesia microti among small wild mammals in northeastern Eurasia and a geographic diversity in the beta-tubulin gene sequences. J Vet Med Sci. 2004;66:785–92. DOIPubMedGoogle Scholar
  24. Zamoto  A, Tsuji  M, Kawabuchi  T, Wei  Q, Asakawa  M, Ishihara  C. US-type Babesia microti isolated from small wild mammals in eastern Hokkaido, Japan. J Vet Med Sci. 2004;66:919–26. DOIPubMedGoogle Scholar
  25. Telford  SR, Mather  TN, Adler  GH, Spielman  A. Short-tailed shrews as reservoirs of the agents of Lyme disease and human babesiosis. J Parasitol. 1990;76:681–3. DOIPubMedGoogle Scholar
  26. Birkenheuer  AJ, Marr  HS, Hladio  N, Acton  AE. Molecular evidence of prevalent dual piroplasma infections in North American raccoons (Procyon lotor). Parasitology. 2008;135:33–7. DOIPubMedGoogle Scholar
  27. Birkenheuer  AJ, Horney  B, Bailey  M, Scott  M, Sherbert  B, Catto  V, Babesia microti-like infections are prevalent in North American foxes. Vet Parasitol. 2010;172:179–82. DOIPubMedGoogle Scholar
  28. Tsuji  M, Zamoto  A, Kawabuchi  T, Kataoka  T, Nakajima  R, Asakawa  M, Babesia microti–like parasites detected in Eurasian red squirrels (Sciurus vulgaris orientis) in Hokkaido, Japan. J Vet Med Sci. 2006;68:643–6. DOIPubMedGoogle Scholar
  29. Bown  KJ, Lambin  X, Telford  G, Heyder-Bruckner  D, Ogden  NH, Birtles  RJ. The common shrew (Sorex araneus): a neglected host of tick-borne infections? Vector Borne Zoonotic Dis. 2011;11:947–53. DOIPubMedGoogle Scholar
  30. Franke  J, Fritzsch  J, Tomaso  H, Straube  E, Dorn  W, Hildebrandt  A. Coexistence of pathogens in host-seeking and feeding ticks within a single natural habitat in central Germany. Appl Environ Microbiol. 2010;76:6829–36. DOIPubMedGoogle Scholar
  31. Franke  J, Meier  F, Moldenhauer  A, Straube  E, Dorn  W, Hildebrandt  A. Established and emerging pathogens in Ixodes ricinus ticks collected from birds on a conservation island in the Baltic Sea. Med Vet Entomol. 2010;24:425–32. DOIPubMedGoogle Scholar
  32. Hildebrandt  A, Franke  J, Meier  F, Sachse  S, Dorn  W, Straube  E. The potential role of migratory birds in transmission cycles of Babesia spp., Anaplasma phagocytophilum, and Rickettsia spp. Ticks Tick Borne Dis. 2010;1:105–7. DOIPubMedGoogle Scholar
  33. Keesing  F, Holt  RD, Ostfeld  RS. Effects of species diversity on disease risk. Ecol Lett. 2006;9:485–98. DOIPubMedGoogle Scholar
  34. LoGiudice  K, Ostfeld  RS, Schmidt  KA, Keesing  F. The ecology of infectious disease: effects of host diversity and community composition on Lyme disease risk. Proc Natl Acad Sci U S A. 2003;100:567–71. DOIPubMedGoogle Scholar
  35. Keesing  F, Brunner  J, Duerr  S, Killilea  M, LoGiudice  K, Schmidt  K, Hosts as ecological traps for the vector of Lyme disease. Proc Biol Sci. 2009;276:3911–9. DOIPubMedGoogle Scholar
  36. Ostfeld  RS, Canham  CD, Oggenfuss  K, Winchcombe  RJ, Keesing  F. Climate, deer, rodents, and acorns as determinants of variation in Lyme disease risk. PLoS Biol. 2006;4:e145. DOIPubMedGoogle Scholar
  37. Goethert  HK, Telford  SR. What is Babesia microti? Parasitology. 2003;127:301–9. DOIPubMedGoogle Scholar
  38. Altschul  SF, Gish  W, Miller  W, Myers  EW, Lipman  DJ. Basic local alignment search tool. J Mol Biol. 1990;215:403–10.PubMedGoogle Scholar
  39. Nakajima  R, Tsuji  M, Oda  K, Zamoto-Niikura  A, Wei  Q, Kawabuchi-Kurata  T, Babesia microti–group parasites compared phylogenetically by complete sequencing of the CCTη gene in 36 isolates. J Vet Med Sci. 2009;71:55–68. DOIPubMedGoogle Scholar
  40. Goethert  HK, Cook  JA, Lance  EW, Telford  SR. Fay and Rausch 1969 revisited: Babesia microti in Alaskan small mammals. J Parasitol. 2006;92:826–31. DOIPubMedGoogle Scholar

Main Article

Page created: November 20, 2012
Page updated: November 20, 2012
Page reviewed: November 20, 2012
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external