Volume 20, Number 4—April 2014
Research
Active Surveillance for Avian Influenza Virus, Egypt, 2010–2012
Table 1
Primers used for H5 and H9 subtyping of avian influenza viruses from Egypt, 2010–2012*
| Primer | Sequence, 5′→3′ | Reference |
|---|---|---|
| M30F2/08 | ATGAGYCTTYTAACCGAGGTCGAAACG | (12) |
| M264R3/08 | TGGACAAANCGTCTACGCTGCAG | |
| H5–155f | ACACATGCYCARGACATACT | (13) |
| H5–699r | CTYTGRTTYAGTGTTGATGT | |
| H9–151f | CTYCACACAGARCACAATGG | |
| H9–638r | GTCACACTTGTTGTTGTRTC | |
| BDH9–4F2 | CAAGCGTGACAACAGAAAATTTGG | Designed in-house† |
| BDH9–2R2 | CTCCTGAGAGAACGTGTCCATACC | |
| H9PROB | FAM CTTACTCGCAATGTCTGGCCTGGTTTTAG BHQ1 | |
| AH5b_Forward | GGA ATGYCCCAAATATGTGAAATCAA | (14) |
| AH5b_R | CCACTCCCCTGCTCRTTGCT | |
| H5PROB | FAM TACCCATACCAACCATCTACCATTCCC BHQ1 | |
| Inf-A F | ACCRATCCTGTCACCTCTGAC | |
| Inf-A R | AGGGCATTYTGGACAAAKCGTCTA | |
| Inf-A POB | FAM TGCAGTCCTCGCTCACTGGGCACG BHQ1 |
*Typing by reverse transcription PCR and quantitative reverse transcription PCR.
†St. Jude Children’s Research Hospital, Memphis, TN, USA.
References
- WHO/OIE/FAO H5N1 Evolution Working Group. Continuing progress towards a unified nomenclature for the highly pathogenic H5N1 avian influenza viruses: divergence of clade 2.2 viruses. Influenza Other Respir Viruses. 2009;3:59–62.PubMedGoogle Scholar
- WHO/OIE/FAO H5N1 Evolution Working Group. Continued evolution of highly pathogenic avian influenza A (H5N1): updated nomenclature. Influenza Other Respir Viruses. 2012;6:1–5.PubMedGoogle Scholar
- El-Shesheny R, Kayali G, Kandeil A, Cai Z, Barakat AB, Ghanim H, Antigenic diversity and cross-reactivity of avian influenza H5N1 viruses in Egypt between 2006 and 2011. J Gen Virol. 2012;93:2564–74. DOIPubMedGoogle Scholar
- World Health Organization. Cumulative number of confirmed human cases for avian influenza A(H5N1) reported to WHO, 2003–2013 [cited 2013 Apr 15]; http://www.who.int/influenza/human_animal_interface/EN_GIP_20130426CumulativeNumberH5N1cases.pdf
- Younan M, Poh MK, Elassal E, Davis T, Rivailler P, Balish AL, Microevolution of highly pathogenic avian influenza A(H5N1) viruses isolated from humans, Egypt, 2007–2011. Emerg Infect Dis. 2013;19:43–50. DOIPubMedGoogle Scholar
- Arafa A, Suarez DL, Hassan MK, Aly MM. Phylogenetic analysis of hemagglutinin and neuraminidase genes of highly pathogenic avian influenza H5N1 Egyptian strains isolated from 2006 to 2008 indicates heterogeneity with multiple distinct sublineages. Avian Dis. 2010;54(Suppl):345–9. DOIPubMedGoogle Scholar
- Herfst S, Schrauwen EJ, Linster M, Chutinimitkul S, de Wit E, Munster VJ, Airborne transmission of influenza A/H5N1 virus between ferrets. Science. 2012;336:1534–41 .DOIPubMedGoogle Scholar
- Imai H, Shinya K, Takano R, Kiso M, Muramoto Y, Sakabe S, The HA and NS genes of human H5N1 influenza A virus contribute to high virulence in ferrets. PLoS Pathog. 2010;6:e1001106. DOIPubMedGoogle Scholar
- Fuller TL, Gilbert M, Martin V, Cappelle J, Hosseini P, Njabo KY, Predicting hotspots for influenza virus reassortment. Emerg Infect Dis. 2013;19:581–8. DOIPubMedGoogle Scholar
- Arafa AS, Hagag N, Erfan A, Mady W, El-Husseiny M, Adel A, Complete genome characterization of avian influenza virus subtype H9N2 from a commercial quail flock in Egypt. Virus Genes. 2012;45:283–94. DOIPubMedGoogle Scholar
- Kayali G, El-Shesheny R, Kutkat MA, Kandeil AM, Mostafa A, Ducatez MF, Continuing threat of influenza (H5N1) virus circulation in Egypt. Emerg Infect Dis. 2011;17:2306–8. DOIPubMedGoogle Scholar
- World Health Organization. WHO manual on animal influenza diagnosis and surveillance. 2nd ed. 2002 [cited 2011 Dec 12]. http://whqlibdoc.who.int/hq/2002/WHO_CDS_CSR_NCS_2002.5.pdf
- Lee MS, Chang PC, Shien JH, Cheng MC, Shieh HK. Identification and subtyping of avian influenza viruses by reverse transcription-PCR. J Virol Methods. 2001;97:13–22. DOIPubMedGoogle Scholar
- Centers for Disease Control and Prevention. CDC realtime RTPCR protocol for detection and characterization of influenza. Atlanta: the Centers; 2007.
- Shanmuganatham K, Feeroz MM, Jones-Engel L, Smith GJ, Fourment M, Walker D, Antigenic and molecular characterization of avian influenza A(H9N2) viruses, Bangladesh. Emerg Infect Dis. 2013;19:1393–402. DOIPubMedGoogle Scholar
- Tamura K, Dudley J, Nei M, Kumar S. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol. 2007;24:1596–9. DOIPubMedGoogle Scholar
- Cai Z, Zhang T, Wan XF. A computational framework for influenza antigenic cartography. PLOS Comput Biol. 2010;6:e1000949. DOIPubMedGoogle Scholar
- Ruppel A, Diesfeld HJ, Rother U. Immunoblot analysis of Schistosoma mansoni antigens with sera of schistosomiasis patients: diagnostic potential of an adult schistosome polypeptide. Clin Exp Immunol. 1985;62:499–506 .PubMedGoogle Scholar
- Kayali G, Webby RJ, Ducatez MF, El Shesheny RA, Kandeil AM, Govorkova EA, The epidemiological and molecular aspects of influenza H5N1 viruses at the human–animal interface in Egypt. PLoS ONE. 2011;6:e17730. DOIPubMedGoogle Scholar
- Kim JK, Negovetich NJ, Forrest HL, Webster RG. Ducks: the “Trojan horses” of H5N1 influenza. Influenza Other Respir Viruses. 2009;3:121–8.
- Uyeki TM. Global epidemiology of human infections with highly pathogenic avian influenza A (H5N1) viruses. Respirology. 2008;13(Suppl 1):S2–9 .DOIPubMedGoogle Scholar
- Aly MM, Arafa A, Kilany WH, Sleim AA, Hassan MK. Isolation of a low pathogenic avian influenza virus (H7N7) from a black kite (Milvus migrans) in Egypt in 2005. Avian Dis. 2010;54(Suppl):457–60. DOIPubMedGoogle Scholar
- Amin A, Shalaby MA, Imam IZ. Studies on influenza virus isolated from migrating birds in Egypt. Comp Immunol Microbiol Infect Dis. 1980;3:241–6. DOIPubMedGoogle Scholar
- Soliman A, Saad M, Elassal E, Amir E, Plathonoff C, Bahgat V, Surveillance of avian influenza viruses in migratory birds in Egypt, 2003–09. J Wildl Dis. 2012;48:669–75 and. DOIPubMedGoogle Scholar
- Aamir UB, Wernery U, Ilyushina N, Webster RG. Characterization of avian H9N2 influenza viruses from United Arab Emirates 2000 to 2003. Virology. 2007;361:45–55. DOIPubMedGoogle Scholar
- Brown IH, Banks J, Manvell RJ, Essen SC, Shell W, Slomka M, Recent epidemiology and ecology of influenza A viruses in avian species in Europe and the Middle East. Dev Biol (Basel). 2006;124:45–50 .PubMedGoogle Scholar
- Moosakhani F, Shoshtari AH, Pourbakhsh SA, Keyvanfar H, Ghorbani A. Phylogenetic analysis of the hemagglutinin genes of 12 H9N2 influenza viruses isolated from chickens in Iran from 2003 to 2005. Avian Dis. 2010;54:870–4. DOIPubMedGoogle Scholar
- Perk S, Banet-Noach C, Shihmanter E, Pokamunski S, Pirak M, Lipkind M, Genetic characterization of the H9N2 influenza viruses circulated in the poultry population in Israel. Comp Immunol Microbiol Infect Dis. 2006;29:207–23. DOIPubMedGoogle Scholar
- Roussan DA, Khawaldeh GY, Al Rifai RH, Totanji WS, Shaheen IA. Avian influenza virus H9 subtype in poultry flocks in Jordan. Prev Vet Med. 2009;88:77–81. DOIPubMedGoogle Scholar
- Khalenkov A, Perk S, Panshin A, Golender N, Webster RG. Modulation of the severity of highly pathogenic H5N1 influenza in chickens previously inoculated with Israeli H9N2 influenza viruses. Virology. 2009;383:32–8 and. DOIPubMedGoogle Scholar
Page created: March 12, 2014
Page updated: March 12, 2014
Page reviewed: March 12, 2014
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.