Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link
Volume 20, Number 4—April 2014
Research

Active Surveillance for Avian Influenza Virus, Egypt, 2010–2012

Ghazi KayaliComments to Author , Ahmed Kandeil, Rabeh El-Shesheny, Ahmed S. Kayed, Mokhtar M. Gomaa, Asmaa M. Maatouq, Mahmoud M. Shehata, Yassmin Moatasim, Ola Bagato, Zhipeng Cai, Adam Rubrum, Mohamed A. Kutkat, Pamela P. McKenzie, Robert G. Webster, Richard J. Webby, and Mohamed A. Ali
Author affiliations: St. Jude Children's Research Hospital, Memphis, Tennessee, USA (G. Kayali, A. Rubrum, P.P. McKenzie, R.G. Webster, R.J. Webby); National Research Center, Giza, Egypt (A. Kandeil, R. El-Shesheny, A.S. Kayed, M.M. Gomaa, A.M. Maatouq, M.M. Shehata, Y. Moatasim, O. Bagato, M.A. Kutkat, M.A. Ali); Georgia State University, Atlanta, Georgia, USA (Z. Cai)

Main Article

Table 1

Primers used for H5 and H9 subtyping of avian influenza viruses from Egypt, 2010–2012*

Primer Sequence, 5′→3′ Reference
M30F2/08 ATGAGYCTTYTAACCGAGGTCGAAACG (12)
M264R3/08 TGGACAAANCGTCTACGCTGCAG
H5–155f ACACATGCYCARGACATACT (13)
H5–699r CTYTGRTTYAGTGTTGATGT
H9–151f CTYCACACAGARCACAATGG
H9–638r GTCACACTTGTTGTTGTRTC
BDH9–4F2 CAAGCGTGACAACAGAAAATTTGG Designed in-house†
BDH9–2R2 CTCCTGAGAGAACGTGTCCATACC
H9PROB FAM CTTACTCGCAATGTCTGGCCTGGTTTTAG BHQ1
AH5b_Forward GGA ATGYCCCAAATATGTGAAATCAA (14)
AH5b_R CCACTCCCCTGCTCRTTGCT
H5PROB FAM TACCCATACCAACCATCTACCATTCCC BHQ1
Inf-A F ACCRATCCTGTCACCTCTGAC
Inf-A R AGGGCATTYTGGACAAAKCGTCTA
Inf-A POB FAM TGCAGTCCTCGCTCACTGGGCACG BHQ1

*Typing by reverse transcription PCR and quantitative reverse transcription PCR.
†St. Jude Children’s Research Hospital, Memphis, TN, USA.

Main Article

References
  1. WHO/OIE/FAO H5N1 Evolution Working Group. Continuing progress towards a unified nomenclature for the highly pathogenic H5N1 avian influenza viruses: divergence of clade 2.2 viruses. Influenza Other Respir Viruses. 2009;3:59–62.PubMedGoogle Scholar
  2. WHO/OIE/FAO H5N1 Evolution Working Group. Continued evolution of highly pathogenic avian influenza A (H5N1): updated nomenclature. Influenza Other Respir Viruses. 2012;6:1–5.PubMedGoogle Scholar
  3. El-Shesheny  R, Kayali  G, Kandeil  A, Cai  Z, Barakat  AB, Ghanim  H, Antigenic diversity and cross-reactivity of avian influenza H5N1 viruses in Egypt between 2006 and 2011. J Gen Virol. 2012;93:2564–74. DOIPubMedGoogle Scholar
  4. World Health Organization. Cumulative number of confirmed human cases for avian influenza A(H5N1) reported to WHO, 2003–2013 [cited 2013 Apr 15]; http://www.who.int/influenza/human_animal_interface/EN_GIP_20130426CumulativeNumberH5N1cases.pdf
  5. Younan  M, Poh  MK, Elassal  E, Davis  T, Rivailler  P, Balish  AL, Microevolution of highly pathogenic avian influenza A(H5N1) viruses isolated from humans, Egypt, 2007–2011. Emerg Infect Dis. 2013;19:43–50. DOIPubMedGoogle Scholar
  6. Arafa  A, Suarez  DL, Hassan  MK, Aly  MM. Phylogenetic analysis of hemagglutinin and neuraminidase genes of highly pathogenic avian influenza H5N1 Egyptian strains isolated from 2006 to 2008 indicates heterogeneity with multiple distinct sublineages. Avian Dis. 2010;54(Suppl):345–9. DOIPubMedGoogle Scholar
  7. Herfst  S, Schrauwen  EJ, Linster  M, Chutinimitkul  S, de Wit  E, Munster  VJ, Airborne transmission of influenza A/H5N1 virus between ferrets. Science. 2012;336:1534–41 .DOIPubMedGoogle Scholar
  8. Imai  H, Shinya  K, Takano  R, Kiso  M, Muramoto  Y, Sakabe  S, The HA and NS genes of human H5N1 influenza A virus contribute to high virulence in ferrets. PLoS Pathog. 2010;6:e1001106. DOIPubMedGoogle Scholar
  9. Fuller  TL, Gilbert  M, Martin  V, Cappelle  J, Hosseini  P, Njabo  KY, Predicting hotspots for influenza virus reassortment. Emerg Infect Dis. 2013;19:581–8. DOIPubMedGoogle Scholar
  10. Arafa  AS, Hagag  N, Erfan  A, Mady  W, El-Husseiny  M, Adel  A, Complete genome characterization of avian influenza virus subtype H9N2 from a commercial quail flock in Egypt. Virus Genes. 2012;45:283–94. DOIPubMedGoogle Scholar
  11. Kayali  G, El-Shesheny  R, Kutkat  MA, Kandeil  AM, Mostafa  A, Ducatez  MF, Continuing threat of influenza (H5N1) virus circulation in Egypt. Emerg Infect Dis. 2011;17:2306–8. DOIPubMedGoogle Scholar
  12. World Health Organization. WHO manual on animal influenza diagnosis and surveillance. 2nd ed. 2002 [cited 2011 Dec 12]. http://whqlibdoc.who.int/hq/2002/WHO_CDS_CSR_NCS_2002.5.pdf
  13. Lee  MS, Chang  PC, Shien  JH, Cheng  MC, Shieh  HK. Identification and subtyping of avian influenza viruses by reverse transcription-PCR. J Virol Methods. 2001;97:13–22. DOIPubMedGoogle Scholar
  14. Centers for Disease Control and Prevention. CDC realtime RTPCR protocol for detection and characterization of influenza. Atlanta: the Centers; 2007.
  15. Shanmuganatham  K, Feeroz  MM, Jones-Engel  L, Smith  GJ, Fourment  M, Walker  D, Antigenic and molecular characterization of avian influenza A(H9N2) viruses, Bangladesh. Emerg Infect Dis. 2013;19:1393–402. DOIPubMedGoogle Scholar
  16. Tamura  K, Dudley  J, Nei  M, Kumar  S. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol. 2007;24:1596–9. DOIPubMedGoogle Scholar
  17. Cai  Z, Zhang  T, Wan  XF. A computational framework for influenza antigenic cartography. PLOS Comput Biol. 2010;6:e1000949. DOIPubMedGoogle Scholar
  18. Ruppel  A, Diesfeld  HJ, Rother  U. Immunoblot analysis of Schistosoma mansoni antigens with sera of schistosomiasis patients: diagnostic potential of an adult schistosome polypeptide. Clin Exp Immunol. 1985;62:499–506 .PubMedGoogle Scholar
  19. Kayali  G, Webby  RJ, Ducatez  MF, El Shesheny  RA, Kandeil  AM, Govorkova  EA, The epidemiological and molecular aspects of influenza H5N1 viruses at the human–animal interface in Egypt. PLoS ONE. 2011;6:e17730. DOIPubMedGoogle Scholar
  20. Kim  JK, Negovetich  NJ, Forrest  HL, Webster  RG. Ducks: the “Trojan horses” of H5N1 influenza. Influenza Other Respir Viruses. 2009;3:121–8.
  21. Uyeki  TM. Global epidemiology of human infections with highly pathogenic avian influenza A (H5N1) viruses. Respirology. 2008;13(Suppl 1):S2–9 .DOIPubMedGoogle Scholar
  22. Aly  MM, Arafa  A, Kilany  WH, Sleim  AA, Hassan  MK. Isolation of a low pathogenic avian influenza virus (H7N7) from a black kite (Milvus migrans) in Egypt in 2005. Avian Dis. 2010;54(Suppl):457–60. DOIPubMedGoogle Scholar
  23. Amin  A, Shalaby  MA, Imam  IZ. Studies on influenza virus isolated from migrating birds in Egypt. Comp Immunol Microbiol Infect Dis. 1980;3:241–6. DOIPubMedGoogle Scholar
  24. Soliman  A, Saad  M, Elassal  E, Amir  E, Plathonoff  C, Bahgat  V, Surveillance of avian influenza viruses in migratory birds in Egypt, 2003–09. J Wildl Dis. 2012;48:669–75 and. DOIPubMedGoogle Scholar
  25. Aamir  UB, Wernery  U, Ilyushina  N, Webster  RG. Characterization of avian H9N2 influenza viruses from United Arab Emirates 2000 to 2003. Virology. 2007;361:45–55. DOIPubMedGoogle Scholar
  26. Brown  IH, Banks  J, Manvell  RJ, Essen  SC, Shell  W, Slomka  M, Recent epidemiology and ecology of influenza A viruses in avian species in Europe and the Middle East. Dev Biol (Basel). 2006;124:45–50 .PubMedGoogle Scholar
  27. Moosakhani  F, Shoshtari  AH, Pourbakhsh  SA, Keyvanfar  H, Ghorbani  A. Phylogenetic analysis of the hemagglutinin genes of 12 H9N2 influenza viruses isolated from chickens in Iran from 2003 to 2005. Avian Dis. 2010;54:870–4. DOIPubMedGoogle Scholar
  28. Perk  S, Banet-Noach  C, Shihmanter  E, Pokamunski  S, Pirak  M, Lipkind  M, Genetic characterization of the H9N2 influenza viruses circulated in the poultry population in Israel. Comp Immunol Microbiol Infect Dis. 2006;29:207–23. DOIPubMedGoogle Scholar
  29. Roussan  DA, Khawaldeh  GY, Al Rifai  RH, Totanji  WS, Shaheen  IA. Avian influenza virus H9 subtype in poultry flocks in Jordan. Prev Vet Med. 2009;88:77–81. DOIPubMedGoogle Scholar
  30. Khalenkov  A, Perk  S, Panshin  A, Golender  N, Webster  RG. Modulation of the severity of highly pathogenic H5N1 influenza in chickens previously inoculated with Israeli H9N2 influenza viruses. Virology. 2009;383:32–8 and. DOIPubMedGoogle Scholar

Main Article

Page created: March 12, 2014
Page updated: March 12, 2014
Page reviewed: March 12, 2014
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external