Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link

Volume 20, Number 4—April 2014

Research

High Rates of Antimicrobial Drug Resistance Gene Acquisition after International Travel, the Netherlands

Christian J.H. von Wintersdorff, John Penders, Ellen E. Stobberingh, Astrid M.L. Oude Lashof, Christian J.P.A. Hoebe, Paul H.M. Savelkoul, and Petra F.G. WolffsComments to Author 
Author affiliations: Maastricht University Medical Center, Maastricht, the Netherlands (C.J.H. von Wintersdorff, J. Penders, E.E. Stobberingh, A.M.L. Oude Lashof, C.J.P.A. Hoebe, P. Savelkoul, P.H.M. Wolffs); South Limburg Public Health Service, Geleen, the Netherlands (C.J.P.A. Hoebe)

Main Article

Table 1

PCR primer/probe sequences and additional PCR conditions to identify antimicrobial resistance genes in gut microbiota after international travel, the Netherlands, 2010–2012

Primer/probe Sequence,* 5′→3′ Final conc., nM Amplicon size, bp Cycling conditions Ref.
16S-rDNA_F TGGAGAGTTTGATCCTGGCTCAG 500 526 95°C, 4 min (18)
16S-rDNA_R
TACCGCGGCTGCTGGCAC
250

35 × 95°C, 15 s; 65°C, 60 s

cfxA_F TGACAGTGAGAGATTTGCTGC 300 150 95°C, 3 min (19)
cfxA_R
GGTCAGCCGACATTTCCTCTT
300

40 × 95°C, 15s; 60°C, 15s; 72°C, 30s

tetM_F ACACGCCAGGACATATGGAT 300 126 95°C, 3 min (19)
tetM_R
GGGAATCCCCATTTTCCTAA
300

40 × 95°C, 15s; 57°C, 15s; 72°C, 30s

tetQ_F CAAGGTGATATCCGCTCTGA 300 128 95°C, 3 min (19)
tetQ_R
GGAAAATCGTTCTTCCAGCA
300

40 × 95°C, 15s; 57°C, 15s; 72°C, 30s

ermB_F AAGGGCATTTAACGACGAAACTG 300 438 95°C, 3 min This study
ermB_R
ATTTATCTGGAACATCTGTGGTATG
300

40 × 95°C, 20s; 60°C, 30s; 72°C, 40s
aac6-aph2_F TTGGGAAGATGAAGTTTTTAGA 300 173 95°C, 3 min (20)
aac6-aph2_R
CCTTTACTCCAATAATTTGGCT
300

40 × 95°C, 15s; 57°C, 20s; 72°C, 30s

CTX-M_F ATGTGCAGYACCAGTAARGTKATGGC 500 336 95°C, 15 min (21)
CTX-M_R ATCACKCGGRTCGCCNGGRAT 500 40 × 95°C, 15s; 58°C, 20s
CTX-M-1 JOE-CCCGACAGCTGGGAGACGAAACGT-BHQ1 100 72°C, 30s
CTX-M-2 6FAM-CAGGTGCTTATCGCTCTCGCTCTGTT-BHQ1 100
CTX-M-9 JOE-CTGGATCGCACTGAACCTACGCTGA-BHQ1 100
CTX-M-2-8-9-25
6FAM-CGACAATACYGCCATGAA-MGB-NFQ
100



NDM_F ATTAGCCGCTGCATTGAT 400 154 95°C, 15 min (22)
NDM_R CATGTCGAGATAGGAAGTG 400 42 × 95°C, 15s; 60°C, 60s
NDM_probe
6FAM- CTG[+C]CA[+G]AC[+A]TT[+C]GGTGC-BHQ1
200



qnrA_F CAGTTTCGAGGATTGCAGTT 400 148 95°C, 15 min (23)
qnrA_R CCTGAACTCTATGCCAAAGC 400 45 × 95°C, 30s; 52°C, 30s;
qnrA_probe
6FAM-AAGGGTGYCACTTCAGCTATGCC-BHQ1
100

72°C, 30s

qnrB_F CAGATTTYCGCGGCGCAAG 400 134 95°C, 15 min (23)
qnrB_R TTCCCACAGCTCRCAYTTTTC 400 45 × 95°C, 30s; 55°C, 30s;
qnrB_probe
6FAM-CGCACCTGGTTTTGYAGYGCMTATATCAC-BHQ1
100

72°C, 30s

qnrS_F TCAAGTGAGTAATCGTATGTA 400 157 95°C, 15 min (23)
qnrS_R GTCTGACTCTTTCAGTGAT 400 45 × 95°C, 30s; 55°C, 30s
qnrS_probe 6FAM-CCAGCGATTTTCAAACAACTCAC-BHQ1 100 72°C, 30s

*Nucleic acids between brackets and preceded by + are locked nucleic acids; nM, nanomolar; conc., concentration; ref., reference.

Main Article

References
  1. Wright  GD. The antibiotic resistome. Expert Opinion on Drug Discovery. 2010;5:779–88.PubMedGoogle Scholar
  2. Zhou  W, Wang  Y, Lin  J. Functional cloning and characterization of antibiotic resistance genes from the chicken gut microbiome. Appl Environ Microbiol. 2012;78:3028–32. DOIPubMedGoogle Scholar
  3. Cheng  G, Hu  Y, Yin  Y, Yang  X, Xiang  C, Wang  B, Functional screening of antibiotic resistance genes from human gut microbiota reveals a novel gene fusion. FEMS Microbiol Lett. 2012;336:11–6. DOIPubMedGoogle Scholar
  4. Torres-Cortés  G, Millan  V, Ramirez-Saad  HC, Nisa-Martinez  R, Toro  N, Martinez-Abarca  F. Characterization of novel antibiotic resistance genes identified by functional metagenomics on soil samples. Environ Microbiol. 2011;13:1101–14. DOIPubMedGoogle Scholar
  5. Sommer  MO, Dantas  G, Church  GM. Functional characterization of the antibiotic resistance reservoir in the human microflora. Science. 2009;325:1128–31. DOIPubMedGoogle Scholar
  6. Wright  GD. Antibiotic resistance in the environment: a link to the clinic? Curr Opin Microbiol. 2010;13:589–94. DOIPubMedGoogle Scholar
  7. Poirel  L, Rodriguez-Martinez  JM, Mammeri  H, Liard  A, Nordmann  P. Origin of plasmid-mediated quinolone resistance determinant qnrA. Antimicrob Agents Chemother. 2005;49:3523–5. DOIPubMedGoogle Scholar
  8. Poirel  L, Kampfer  P, Nordmann  P. Chromosome-encoded ambler class a beta-lactamase of Kluyvera georgiana, a probable progenitor of a subgroup of CTX-M extended-spectrum beta-lactamases. Antimicrob Agents Chemother. 2002;46:4038–40. DOIPubMedGoogle Scholar
  9. Penders  J, Stobberingh  EE, Savelkoul  PH, Wolffs  PF. The human microbiome as a reservoir of antimicrobial resistance. Frontiers in Microbiology. 2013;4:87.
  10. Baquero  F. Metagenomic epidemiology: a public health need for the control of antimicrobial resistance. Clin Microbiol Infect. 2012;18(Suppl 4):67–73. DOIPubMedGoogle Scholar
  11. Eckburg  PB, Bik  EM, Bernstein  CN, Purdom  E, Dethlefsen  L, Sargent  M, Diversity of the human intestinal microbial flora. Science. 2005;308:1635–8. DOIPubMedGoogle Scholar
  12. van der Bij  AK, Pitout  JD. The role of international travel in the worldwide spread of multiresistant enterobacteriaceae. J Antimicrob Chemother. 2012;67:2090–100. DOIPubMedGoogle Scholar
  13. Kennedy  K, Collignon  P. Colonisation with Escherichia coli resistant to “critically important” antibiotics: a high risk for international travellers. Eur J Clin Microbiol Infect Dis. 2010;29:1501–6. DOIPubMedGoogle Scholar
  14. Tängdén  T, Cars  O, Melhus  A, Lowdin  E. Foreign travel is a major risk factor for colonization with Escherichia coli producing CTX-M–type extended-spectrum beta-lactamases: a prospective study with Swedish volunteers. Antimicrob Agents Chemother. 2010;54:3564–8. DOIPubMedGoogle Scholar
  15. Ostholm-Balkhed  A, Tarnberg  M, Nilsson  M, Nilsson  LE, Hanberger  H, Hallgren  A, Travel-associated faecal colonization with ESBL-producing enterobacteriaceae: Incidence and risk factors. J Antimicrob Chemother. 2013;68:2144–53 . DOIPubMedGoogle Scholar
  16. Paltansing  S, Vlot  JA, Kraakman  MEM, Mesman  R, Bruijning  ML, Bernards  AT, Extended-spectrum β-lactamase–producing enterobacteriaceae among travelers from the Netherlands. Emerg Infect Dis. 2013;19:1206–13. DOIPubMedGoogle Scholar
  17. Collignon  P. Resistant Escherichia coli—we are what we eat. Clin Infect Dis. 2009;49:202–4 . DOIPubMedGoogle Scholar
  18. Vliegen  I, Jacobs  JA, Beuken  E, Bruggeman  CA, Vink  C. Rapid identification of bacteria by real-time amplification and sequencing of the 16s rRNA gene. J Microbiol Methods. 2006;66:156–64. DOIPubMedGoogle Scholar
  19. Kim  SM, Kim  HC, Lee  SW. Characterization of antibiotic resistance determinants in oral biofilms. J Microbiol. 2011;49:595–602. DOIPubMedGoogle Scholar
  20. Martineau  F, Picard  FJ, Lansac  N, Menard  C, Roy  PH, Ouellette  M, Correlation between the resistance genotype determined by multiplex PCR assays and the antibiotic susceptibility patterns of Staphylococcus aureus and Staphylococcus epidermidis. Antimicrob Agents Chemother. 2000;44:231–8. DOIPubMedGoogle Scholar
  21. Birkett  CI, Ludlam  HA, Woodford  N, Brown  DF, Brown  NM, Roberts  MT, Real-time TaqMan PCR for rapid detection and typing of genes encoding CTX-M extended-spectrum beta-lactamases. J Med Microbiol. 2007;56:52–5. DOIPubMedGoogle Scholar
  22. Naas  T, Ergani  A, Carrer  A, Nordmann  P. Real-time PCR for detection of NDM-1 carbapenemase genes from spiked stool samples. Antimicrob Agents Chemother. 2011;55:4038–43. DOIPubMedGoogle Scholar
  23. Vien  LTM, Minh  NN, Thuong  TC, Khuong  HD, Nga  TV, Thompson  C, The co-selection of fluoroquinolone resistance genes in the gut flora of Vietnamese children. PLoS ONE. 2012;7:e42919. DOIPubMedGoogle Scholar
  24. Pfaffl  MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001;29:e45. DOIPubMedGoogle Scholar
  25. Reuland  EA, Overdevest  IT, Al Naiemi  N, Kalpoe  JS, Rijnsburger  MC, Raadsen  SA, High prevalence of ESBL-producing enterobacteriaceae carriage in Dutch community patients with gastrointestinal complaints. Clin Microbiol Infect. 2013;19:542–9. DOIPubMedGoogle Scholar
  26. Leverstein-van Hall  MA, Dierikx  CM, Cohen Stuart  J, Voets  GM, van den Munckhof  MP, van Essen-Zandbergen  A, Dutch patients, retail chicken meat and poultry share the same ESBL genes, plasmids and strains. Clin Microbiol Infect. 2011;17:873–80. DOIPubMedGoogle Scholar
  27. Martínez-Martínez  L, Pascual  A, Jacoby  GA. Quinolone resistance from a transferable plasmid. Lancet. 1998;351:797–9. DOIPubMedGoogle Scholar
  28. Hopkins  KL, Wootton  L, Day  MR, Threlfall  EJ. Plasmid-mediated quinolone resistance determinant qnrs1 found in Salmonella enterica strains isolated in the UK. J Antimicrob Chemother. 2007;59:1071–5. DOIPubMedGoogle Scholar
  29. Karczmarczyk  M, Stephan  R, Hachler  H, Fanning  S. Complete nucleotide sequence of pVQS1 containing a quinolone resistance determinant from Salmonella enterica serovar virchow associated with foreign travel. J Antimicrob Chemother. 2012;67:1861–4. DOIPubMedGoogle Scholar
  30. Taguchi  M, Kawahara  R, Seto  K, Inoue  K, Hayashi  A, Yamagata  N, Plasmid-mediated quinolone resistance in Salmonella isolated from patients with overseas travelers' diarrhea in Japan. Jpn J Infect Dis. 2009;62:312–4 http://www0.nih.go.jp/JJID/62/312.html.PubMedGoogle Scholar
  31. Kanamori  H, Yano  H, Hirakata  Y, Hirotani  A, Arai  K, Endo  S, Molecular characteristics of extended-spectrum beta-lactamases and qnr determinants in enterobacter species from Japan. PLoS ONE. 2012;7:e37967. DOIPubMedGoogle Scholar
  32. Strahilevitz  J, Jacoby  GA, Hooper  DC, Robicsek  A. Plasmid-mediated quinolone resistance: a multifaceted threat. Clin Microbiol Rev. 2009;22:664–89. DOIPubMedGoogle Scholar
  33. Jiang  Y, Zhou  Z, Qian  Y, Wei  Z, Yu  Y, Hu  S, Plasmid-mediated quinolone resistance determinants qnr and aac(6')-ib-cr in extended-spectrum beta-lactamase-producing Escherichia coli and Klebsiella pneumoniae in China. J Antimicrob Chemother. 2008;61:1003–6. DOIPubMedGoogle Scholar
  34. Dahmen  S, Poirel  L, Mansour  W, Bouallegue  O, Nordmann  P. Prevalence of plasmid-mediated quinolone resistance determinants in enterobacteriaceae from Tunisia. Clin Microbiol Infect. 2010;16:1019–23.PubMedGoogle Scholar

Main Article

*These authors contributed equally to this article and are co–first authors.

Page created: March 12, 2014
Page updated: March 12, 2014
Page reviewed: March 12, 2014
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external