Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link
Volume 21, Number 10—October 2015
Letter

Human Infections with Pseudoterranova cattani Nematodes, Chile

Thomas Weitzel1, Hiromu Sugiyama, Hiroshi Yamasaki, Cristian Ramirez, Reinaldo Rosas, and Rubén Mercado1Comments to Author 
Author affiliations: Clínica Alemana-Universidad del Desarrollo, Santiago, Chile (T. Weitzel, R. Rosas); National Institute of Infectious Diseases, Tokyo, Japan (H. Sugiyama, H. Yamasaki); Universidad Mayor, Santiago (C. Ramirez); Universidad de Chile, Santiago (R. Mercado)

Main Article

Table

Alignment (comparison) of nucleotide sequences of the ITS1 gene of Pseudoterranova cattani and the Chilean specimen and P. decipiens*

Isolate ITS1 sequence at 240–270 nt GenBank accession no.
Pc1 CTCTGTT--------------AACGCAGAGT AJ413981
CL#3 CTCTGTT--------------AACGCAGAGT KF781284
PdCa1 CTCTGTTTTGGTTTCAACGCTAACGCAGAGT AJ413979

*CL#3, specimen from Chile; Pc1; ITS, internal transcribed spacer. Pc1, P. cattani; PdCa1, P. decipiens.

Main Article

1These authors contributed equally to this article.

Page created: January 19, 2016
Page updated: January 19, 2016
Page reviewed: January 19, 2016
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external