Collection of Ticks from Vegetation

During June and July 2013, we collected ticks (questing larvae, nymphs, and adults) in Jiaonan County, Shandong Province, China (119°30′–120°30′, 35°35′–36°08′), by flagging over vegetation with a 1-m² flannel flag. Tick collection was performed for 4 days during the first week of each month between 10:00 am and 12:00 pm and between 2:00 pm and 5:00 pm; different sites were used for each collection. The ticks were frozen at −80°C until use. Tick species and developmental stages were identified morphologically, and the tick species was molecularly confirmed. The use of the animals and the collection of samples were approved by the bioethics committee of School of Public Health, Shandong University.

Tick Nucleotide Extraction and Identification by PCR

Ticks were grouped according to their developmental stages; each group contained 40 larvae, 20 nymphs, or 5 adult ticks. Sex of the ticks was ignored. Ticks in each group were homogenized by using metal beads and Buffer RLT in a TissueLyser LT (both from QIAGEN, Hilden, Germany). The total nucleotides (DNA and RNA) were extracted simultaneously by using the AllPrep DNA/RNA Mini Kit (QIAGEN) according to the manufacturer’s instructions. Two larval ticks, 1 nymphal tick, and 2 adult ticks were processed individually for rRNA extraction and PCR amplification of the tick mitochondrial 16S rRNA gene. The tick mitochondrial 16S RNA gene forward primer (5′-AGTATTTTGACTATACAAAGGTATTG-3′) and reverse primer (5′-GTAGGATTTTAAAAGTTGAACAAACTT-3′) were designed in this study by using a previously published sequence (GenBank accession no. KC203361) as template. The PCR cycle consisted of an initial DNA denaturation step at 95°C for 2 min; 35 cycles of 30 s at 92°C, 30 s at 55°C, and 45 s at 72°C; and a final extension step of 10 min at 72°C. The PCR product was 402 bp and was sequenced on both strands.

Detection of SFTSV in Ticks by Reverse Transcription PCR (RT-PCR)

The extracted SFTSV RNA was amplified by using a one-step RT-PCR (Access RT-PCR System Kit, Promega, Madison, WI, USA) with primers derived from the small RNA segment of the virus. The RT-PCR primers (CAGCCAGTTTACCCGAACAT and GAAAGACGCAAAGGAGT) and PCR protocol were described previously (10). The one-step RT-PCR consisted of 45 min at 45°C and 2 min at 94°C; 40 cycles of 30 s at 94°C, 1 min at 60°C, and 2 min at 68°C; and a final extension of 10 min at 68°C. The RT-PCR product was used as template for a nested PCR, which consisted of a denaturing cycle of 5 min at 95°C; 30 cycles of 20 s at 94°C, 30 s at 56°C, and 1 min at 72°C; and a final extension of 10 min at 72°C. A negative control with sterilized distilled water was run simultaneously. Nested PCR was performed with primers (5′-TGGCTCCGCGCATCTTCACA-3′ and 5′-AGAGTGGTCCAGGATTGCTGTGG-3′), using the RT-PCR product as template (11). The amplified DNA was subjected to electrophoresis on a 0.8% agarose gel and visualized under ultraviolet light. The desired 560-bp DNA band was excised and purified from the gel by using the Gel Extraction Kit (QIAGEN). The purified PCR product was cloned into a pMD 19-T vector (TaKaRa Bio Inc., Shiga, Japan), according to the manufacturer’s instructions. Positive clones were sequenced on both strands.

Phylogenetic Analysis

The SFTSV sequences and tick mitochondrial 16S rRNA gene sequences derived from tick nucleotides were compared with sequences in GenBank by using BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi). Phylogenetic trees were constructed by using the neighbor-joining method in MEGA5 (12), and the robustness of the trees was tested by using 1,000 bootstrap replications. The sequences generated in this study were deposited in GenBank (accession nos. KP300821, KR259990–KR25993 for ticks and KP197680–KP197687 for SFTSV).

Establishment of a Tick Colony and Transmission Feeding Experiments

A colony of parthenogenic H. longicornis tick was established in our laboratory. Initially, adult female ticks collected from vegetation were placed inside a bag attached to a rabbit ear to feed. Each engorged tick was allowed to lay eggs in a plastic tube. Approximately a half clutch of eggs from each female tick was used for RNA extraction and testing for SFTSV by RT-PCR. Larvae were allowed to hatch from the remaining half clutches, and larvae from a single tick that was negative for SFTSV by RT-PCR were used for all subsequent experiments.

SFTSV acquisition and transmission feeding were performed for all stages of ticks by using Kunming mice (Shandong University Experimental Animal Center, Jinan City, China). For the experiments, ticks were placed in feeding capsules, which were prepared from the top of 1-mL screwcap cryovials. The top part of the tube beneath the cap was cut, and the cap of the tube was punctured by using a 26-gauge needle for adequate air exchange. Mice were anesthetized by intraperitoneal injection of 0.1 mL of 10% chloral hydrate. Hair on the back of each mouse was trimmed close to the skin by using a small electric razor, and a capsule was affixed to the back with Kamar glue (Kamar Products Inc., Zionsville, IN, USA). To secure the capsule in place, a round patch of cloth (≈1 cm diameter) with a hole in the middle that was slightly smaller than the capsule (to allow access to the capsule) was placed over the capsule and affixed to the skin with glue. A collar made from thin plastic was placed around the body of the mouse in front of the capsule to prevent the mouse from removing the capsule during grooming.

A total of 50 larvae, 15 nymphs, or 1 adult tick was placed in the capsule on each mouse 24 h after the capsule was affixed to the mouse. Ticks in the capsule were observed daily and collected after completion of feeding. For the virus acquisition feeding, each mouse was inoculated intraperitoneally with DH82 cells containing 10⁶ plaque forming units of SFTSV, and ticks were fed on the SFTSV-infected mice for 3–8 days until engorged. For virus transmission feeding, SFTSV-infected ticks were fed on noninfected mice for 3–8 days until engorged. We collected blood samples from each mouse 7, 14, and 21 days after tick feeding for detection of SFTSV. The SFTSV in the laboratory-reared ticks and in the mouse blood was detected by RT-PCR using the primer pair CAGCCACTTCACCCGAACAT and AAGGAAAGACGCAAAGGAG, which was designed in this study. The amplification cycles were the same as those described above for the RT-PCR for detection of SFTSV in ticks from vegetation. The PCR product was 560 bp.

Detection of SFTSV RNA and Antibody in Blood of Mice after Tick Feeding

Mouse blood samples were collected weekly for 3 weeks. Total RNA was extracted from each blood sample by using the RNeasy Mini Kit (QIAGEN) and was used as a template for amplification (Access RT-PCR System; Promega) of SFTSV. Primers for RT-PCR and the PCR protocol were as described in the preceding paragraph. SFTSV antibody was assayed by using SFTSV-infected DH82 cells as antigens. The cells were cultivated in a 96-well plate, fixed with 4% paraformaldehyde, and used as antigens for immunofluorescence assays (IFAs) to detect SFTSV antibodies in serum samples from mice fed on by SFTSV-infected ticks.

The Prevalence of SFTSV in Ticks from Vegetation

Figure 1

Figure 1. Phylogenetic analysis of mitochondrial 16S rRNA gene of ticks collected during June–July 2014 from Jiaonan County, Shandong Province, China. The results showed that the larval, nymphal, and adult ticks (indicated by...

Figure 2

Figure 2. Phylogenetic analysis of severe fever with thrombocytopenia syndrome virus (SFTSV) small segment sequences from ticks collected during June–July 2014 from Jiaonan County, Shandong Province, China. Dots indicate SFTSV sequences amplified from...

We collected 3,300 ticks from vegetation, morphologically identified them as H. longicornis ticks, and molecularly confirmed the identification by sequencing the mitochondrial 16S RNA gene of representatives of larval, nymphal, and adult ticks (Figure 1). To detect SFTSV, we pooled the ticks according to their developmental stage, and tested each pool for SFTSV RNA by RT-PCR and nested PCR. The prevalence of SFTSV infection in each stage of the tick was determined by the assumption that a positive pool of ticks contained 1 SFTSV-infected tick. The prevalence of SFTSV infection was 0.2% (8/3,300) among ticks of all stages. The prevalence of SFTSV infection was 0 among 120 larvae, 0.1% (2/1,620) among nymphs, and 0.4% (6/1,560) among adult ticks. Phylogenetic analysis showed that all sequences of SFTSV amplified from ticks were clustered with SFTSV from Shandong Province and other places in China (Figure 2). These results suggested that nymph and adult ticks were infected with SFTSV, but the rate of carriage was very low.

SFTSV Infection of Ticks by Acquisition Feeding and Tick Transovarial Transmission of SFTSV

To determine whether ticks could be infected by SFTSV, we fed all stages (larvae, nymphs, and adults) of H. longicornis ticks on SFTSV-infected mice. In larval acquisition feeding, the engorged larvae were tested for SFTSV by RT-PCR before or after molting. Five larval ticks were grouped together as a pool for RNA extraction and RT-PCR amplification of SFTSV. The minimum infection rate (assuming that an infected pool of ticks contained 1 SFTSV-infected tick) was 18% (9/50) for engorged larval pools and 11.7% (14/120) for molted nymphs (Table 1). These results indicated that larvae could acquire SFTSV from infected mice and transstadially transmit SFTSV to nymphs.

In nymphal acquisition feeding, 10 engorged nymphs were tested individually, and all were found to be infected with SFTSV; however, only 20% (2/10) of the adults ticks derived from the nymphs were infected with SFTSV (Table 1). These results indicated that nymphs could acquire SFTSV from infected mice and transstadially transmit SFTSV to adult ticks.

For adult tick acquisition feeding, uninfected adult ticks were fed on SFTSV-infected mice until completion of feeding. Thirteen engorged adult ticks were tested individually for SFTSV, and 6 (46.2%) of them were infected with SFTSV, as determined by RT-PCR. Thirteen engorged adult ticks had oviposited, and the larvae hatched. Larvae derived from each tick were tested as a group for SFTSV RNA by RT-PCR, and 53.8% (7/13) of the larval pools were infected with SFTSV (Table 1). The results of these experiments indicated that adult female ticks could transovarially transmit SFTSV.

Tick Transmission of SFTSV to Mice

To determine whether SFTSV could be transmitted to mice by tick bite, we fed SFTSV-infected nymphs and adults on Kunming albino mice. For study of nymph feeding transmission of SFTSV, 10 uninfected mice were fed upon by 10 nymphs molted from larvae that fed on SFTSV-infected mice until engorged. At 7, 14, and 21 days after the feeding, blood samples were obtained from the mice and examined by RT-PCR to detect SFTSV; viral RNA was detected in 40% (4/10) of the mice. These results indicated that nymphs transmitted SFTSV to mice through feeding.

For study of adult tick feeding transmission of SFTSV, the adult ticks were molted from engorged nymphs obtained from the 10 mice mentioned above. To determine whether SFTSV was transmitted from nymphs to adult ticks and whether adult ticks could transmit SFTSV to mice, 20 adult ticks were fed individually on 20 naive mice until engorged. At 7, 14, and 21 days after the feeding, blood samples were obtained from the mice and examined by RT-PCR to detect SFTSV; viral RNA was detected in 10.0% (2/20) of the mice on days 7 and 14. These results indicated that the adult ticks used in this study were infected in the larval stage by feeding on SFTSV-infected mice.

Figure 3

Figure 3. Immunofluorescence assay detection of severe fever with thrombocytopenia syndrome virus (SFTSV) antibodies in serum samples from mice fed by SFTSV-infected ticks. A) Normal mouse serum (negative control) reacting with SFTSV-infected DH82...

Using an IFA, we determined whether SFTSV antibodies were present in serum samples from mice fed upon by nymphal and adult ticks. All SFTSV RT-PCR–positive mouse serum samples were also positive by IFA at various titers (Table 2; Figure 3), but none of the SFTSV RT-PCR–negative mouse samples were positive by IFA. The results indicated that larvae acquired SFTSV from infected mice and transmitted the virus transstadially to nymphs and adult ticks, and nymphs and adult ticks transmitted SFTSV to mice during feeding.