Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link

Volume 24, Number 12—December 2018

Dispatch

Candidatus Cryptoplasma Associated with Green Lizards and Ixodes ricinus Ticks, Slovakia, 2004–2011

Božena Kočíková, Igor Majláth, Bronislava Víchová, Lenka Maliničová, Peter Pristaš, Vincent A. Connors, and Viktória MajláthováComments to Author 
Author affiliations: Slovak Academy of Sciences, Košice, Slovakia (B. Kočíková, B. Víchová, P. Pristaš, V. Majláthová); Pavol Jozef Šafárik University in Košice, Košice (I. Majláth, L. Maliničová, P. Pristaš, V. Majláthová); University of South Carolina Upstate, Spartanburg, South Carolina, USA (V.A. Connors)

Main Article

Table 1

Primers used to amplify 16S rRNA gene of Candidatus Cryptoplasma sp. found in green lizards and Ixodes ricinus ticks, Slovakia, 2004–2011

Organism Primer name Sequences, 5′ → 3′ Length of amplified fragment, bp Reference
Family Anaplasmataceae EHR747 GCACTCATCGTTTACAGCGTG 247 (10)

EHR521
TGTAGGCGGTTCGGTAAGTTAAAG


Most eubacteria fD1 ccgaattcgtcgacaacAGAGTTTGATCCTGGCTCAG 1,500 (9)
rP2 cccgggatccaagcttACGGCTACCTTGTTACGACTT

Main Article

References
  1. Dumler  JS. Anaplasma and Ehrlichia infection. Ann N Y Acad Sci. 2005;1063:361–73. DOIPubMedGoogle Scholar
  2. Rikihisa  Y. Mechanisms to create a safe haven by members of the family Anaplasmataceae. Ann N Y Acad Sci. 2003;990:548–55. DOIPubMedGoogle Scholar
  3. Rar  V, Golovljova  I. Anaplasma, Ehrlichia, and “Candidatus Neoehrlichia” bacteria: pathogenicity, biodiversity, and molecular genetic characteristics, a review. Infect Genet Evol. 2011;11:1842–61. DOIPubMedGoogle Scholar
  4. Eshoo  MW, Carolan  HE, Massire  C, Chou  DM, Crowder  CD, Rounds  MA, et al. Survey of Ixodes pacificus ticks in California reveals a diversity of microorganisms and a novel and widespread Anaplasmataceae species. PLoS One. 2015;10:e0135828. DOIPubMedGoogle Scholar
  5. Nieto  NC, Foley  JE, Bettaso  J, Lane  RS. Reptile infection with Anaplasma phagocytophilum, the causative agent of granulocytic anaplasmosis. J Parasitol. 2009;95:1165–70. DOIPubMedGoogle Scholar
  6. Rejmanek  D, Bradburd  G, Foley  J. Molecular characterization reveals distinct genospecies of Anaplasma phagocytophilum from diverse North American hosts. J Med Microbiol. 2012;61:204–12. DOIPubMedGoogle Scholar
  7. Tijsse-Klasen  E, Fonville  M, Reimerink  JHJ, Spitzen-van der Sluijs  A, Sprong  H. Role of sand lizards in the ecology of Lyme and other tick-borne diseases in the Netherlands. Parasit Vectors. 2010;3:42. DOIPubMedGoogle Scholar
  8. Ekner  A, Dudek  K, Sajkowska  Z, Majláthová  V, Majláth  I, Tryjanowski  P. Anaplasmataceae and Borrelia burgdorferi sensu lato in the sand lizard Lacerta agilis and co-infection of these bacteria in hosted Ixodes ricinus ticks. Parasit Vectors. 2011;4:182. DOIPubMedGoogle Scholar
  9. Weisburg  WG, Barns  SM, Pelletier  DA, Lane  DJ. 16S ribosomal DNA amplification for phylogenetic study. J Bacteriol. 1991;173:697–703. DOIPubMedGoogle Scholar
  10. Pancholi  P, Kolbert  CP, Mitchell  PD, Reed  KD Jr, Dumler  JS, Bakken  JS, et al. Ixodes dammini as a potential vector of human granulocytic ehrlichiosis. J Infect Dis. 1995;172:1007–12. DOIPubMedGoogle Scholar
  11. Derdáková  M, Beati  L, Pet’ko  B, Stanko  M, Fish  D. Genetic variability within Borrelia burgdorferi sensu lato genospecies established by PCR-single-strand conformation polymorphism analysis of the rrfA-rrlB intergenic spacer in ixodes ricinus ticks from the Czech Republic. Appl Environ Microbiol. 2003;69:509–16. DOIPubMedGoogle Scholar
  12. Tamura  K, Stecher  G, Peterson  D, Filipski  A, Kumar  S. MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Mol Biol Evol. 2013;30:2725–9. DOIPubMedGoogle Scholar
  13. Stefancíková  A, Derdáková  M, Lencáková  D, Ivanová  R, Stanko  M, Cisláková  L, et al. Serological and molecular detection of Borrelia burgdorferi sensu lato and Anaplasmataceae in rodents. Folia Microbiol (Praha). 2008;53:493–9. DOIPubMedGoogle Scholar

Main Article

Page created: November 19, 2018
Page updated: November 19, 2018
Page reviewed: November 19, 2018
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external