Volume 24, Number 2—February 2018
Research
Macacine Herpesvirus 1 Antibody Prevalence and DNA Shedding among Invasive Rhesus Macaques, Silver Springs State Park, Florida, USA
Table 1
PCR oligonucleotide primers and probe used in the detection of McHV-1 viral DNA in samples from rhesus macaques and soil, Silver Springs State Park, Florida, USA, 2000–2012*
PCR target | Reference | Sequence, 5′ → 3′ |
---|---|---|
gGBV-323F | (21) | TGGCCTACTACCGCGTGG |
gGBV-446R | (21) | TGGTACGTGTGGGAGTCGCG |
gGBV-403T | (21) | (6-FAM)CCGCCCTCTCCGAGCACGTG(BHQ-1) |
DFA | (22) | GAYTTYGCNAGYYTNTAYCC |
ILK | (22) | TCCTGGACAAGCAGCARNYSGCNMTNAA |
KG1 | (22) | GTCTTGCTCACCAGNTCNACNCCYTT |
TGV | (22) | TGTAACTCGGTGTAYGGNTTYACNGGNGT |
IYG | (22) | CACAGAGTCCGTRTCNCCRTADAT |
HB2A | (8) | CCGCGCTCGCCACGGACACCA |
HB2B | (8) | ATCGCGCGCCGGACCGATCGT |
AS9 | (23) | TC[A/T]CCCGGGCTAGACTT[T/C][A/C]TCTTCCTGCTCAG |
AS2 | (23) | ATGGCGGCCAGGGTCAGCGCGCAGAGG |
AS8 | (23) | CTCTGCGCGCTGACCCTGGCCGCCATGG |
AS7 | (23) | CACGTCGGGGGG[G/A]TCCGTCTTCTGCTCC |
*BHQ-1, black hole quencher 1; 6-FAM, 6-fluorescein amidite; gG, glycoprotein G; McHV-1, macacine herpesvirus 1.
References
- Pedersen AB, Davies TJ. Cross-species pathogen transmission and disease emergence in primates. EcoHealth. 2009;6:496–508. DOIPubMedGoogle Scholar
- Kairo M, Ali B, Cheesman O, Haysom K, Murphy S. Invasive species threats in the Caribbean region: report to the Nature Conservancy. Curepe (Trinidad and Tobago): CAB International; 2003.
- Anderson CJ, Hostetler ME, Johnson SA. History and status of introduced non-human primate populations in Florida. Southeast Nat. 2017;16:19–36. DOIGoogle Scholar
- Hannibal DL, Bliss-Moreau E, Vandeleest J, McCowan B, Capitanio J. Laboratory rhesus macaque social housing and social changes: Implications for research. Am J Primatol. 2017;79:1–14. DOIPubMedGoogle Scholar
- Centers for Disease Control and Prevention. B virus (herpes B, monkey B virus, herpesvirus simiae, and herpesvirus B). Atlanta: The Centers; 2016 [cited 2017 Aug 14]. https://www.cdc.gov/herpesbvirus/index.html
- Holmes GP, Chapman LE, Stewart JA, Straus SE, Hilliard JK, Davenport DS; the B Virus Working Group. Guidelines for the prevention and treatment of B-virus infections in exposed persons. The B virus Working Group. Clin Infect Dis. 1995;20:421–39. DOIPubMedGoogle Scholar
- Pellett P, Roizman B. The family Herpesviridae: a brief introduction. In: Knipe D and Howley P, editors. Fields virology, 6th ed. Philadelphia: Lippincott Williams and Wilkins; 2013. p. 1802–2.
- Oya C, Ochiai Y, Taniuchi Y, Takano T, Fujima A, Ueda F, et al. Prevalence of herpes B virus genome in the trigeminal ganglia of seropositive cynomolgus macaques. Lab Anim. 2008;42:99–103. DOIPubMedGoogle Scholar
- Engel GA, Jones-Engel L, Schillaci MA, Suaryana KG, Putra A, Fuentes A, et al. Human exposure to herpesvirus B-seropositive macaques, Bali, Indonesia. Emerg Infect Dis. 2002;8:789–95. DOIPubMedGoogle Scholar
- Jensen K, Alvarado-Ramy F, González-Martínez J, Kraiselburd E, Rullán J. B-virus and free-ranging macaques, Puerto Rico. Emerg Infect Dis. 2004;10:494–6. DOIPubMedGoogle Scholar
- Jones-Engel L, Engel GA, Heidrich J, Chalise M, Poudel N, Viscidi R, et al. Temple monkeys and health implications of commensalism, Kathmandu, Nepal. Emerg Infect Dis. 2006;12:900–6. DOIPubMedGoogle Scholar
- Tischer BK, Osterrieder N. Herpesviruses—a zoonotic threat? Vet Microbiol. 2010;140:266–70. DOIPubMedGoogle Scholar
- Lee MH, Rostal MK, Hughes T, Sitam F, Lee CY, Japning J, et al. Macacine herpesvirus 1 in long-tailed macaques, Malaysia, 2009–2011. Emerg Infect Dis. 2015;21:1107–13. DOIPubMedGoogle Scholar
- Anderson CJ, Hostetler ME, Sieving KE, Johnson SA. Predation of artificial nests by introduced rhesus macaques (Macaca mulatta) in Florida, USA. Biol Invasions. 2016;18:2783–9. DOIGoogle Scholar
- Wolfe LD, Peters EH. History of the freeranging rhesus monkeys (Macaca mulatta) of Silver Springs. Fla Sci. 1987;50:234–45.
- Wolfe LD. Rhesus macaques: a comparative study of two sites, Jaipur, India, and Silver Springs, Florida. In: Fuentes A, Wolfe LD, editors. Primates face to face: the conservation implications of human-nonhuman primate interconnections. Cambridge: Cambridge University Press; 2002. p. 310–30.
- Montague CL, Colwell SV, Percival HF, Gottgens JF. Issues and options related to management of Silver Springs rhesus macaques. Report no. 49. Tallahassee (FL): Florida Game and Fresh Water Fish Commission; 1994.
- Burgos-Rodriguez AG. Zoonotic diseases of primates. Vet Clin North Am Exot Anim Pract. 2011;14:557–75, viii. DOIPubMedGoogle Scholar
- Anderson CJ. Ecology and impacts of introduced non-human primate populations in Florida [dissertation]. Gainesville (FL): University of Florida. In press.
- Weigler BJ. Biology of B virus in macaque and human hosts: a review. Clin Infect Dis. 1992;14:555–67. DOIPubMedGoogle Scholar
- Brown LD, Cai TT, DasGupta A. Interval estimation for a binomial proportion. Stat Sci. 2001;16:101–33. DOIGoogle Scholar
- Perelygina L, Patrusheva I, Manes N, Wildes MJ, Krug P, Hilliard JK. Quantitative real-time PCR for detection of monkey B virus (Cercopithecine herpesvirus 1) in clinical samples. J Virol Methods. 2003;109:245–51. DOIPubMedGoogle Scholar
- VanDevanter DR, Warrener P, Bennett L, Schultz ER, Coulter S, Garber RL, et al. Detection and analysis of diverse herpesviral species by consensus primer PCR. J Clin Microbiol. 1996;34:1666–71.PubMedGoogle Scholar
- Smith AL, Black DH, Eberle R. Molecular evidence for distinct genotypes of monkey B virus (herpesvirus simiae) which are related to the macaque host species. J Virol. 1998;72:9224–32.PubMedGoogle Scholar
- Nei M, Kumar S. Molecular evolution and phylogenetics. New York: Oxford University Press; 2000.
- Weigler BJ, Roberts JA, Hird DW, Lerche NW, Hilliard JK. A cross sectional survey for B virus antibody in a colony of group housed rhesus macaques. Lab Anim Sci. 1990;40:257–61.PubMedGoogle Scholar
- Weigler BJ, Hird DW, Hilliard JK, Lerche NW, Roberts JA, Scott LM, et al. Epidemiology of cercopithecine herpesvirus 1 (B virus) infection and shedding in a large breeding cohort of rhesus macaques. J Infect Dis. 1993;167:257–63. DOIPubMedGoogle Scholar
- Elmore D, Eberle R. Monkey B virus (Cercopithecine herpesvirus 1). Comp Med. 2008;58:11–21.PubMedGoogle Scholar
- Eberle R, Maxwell LK, Nicholson S, Black D, Jones-Engel L. Genome sequence variation among isolates of monkey B virus (Macacine alphaherpesvirus 1) from captive macaques. Virology. 2017;508:26–35. DOIPubMedGoogle Scholar
- Maestripieri D. Rhesus macaques. In: Breed MD and Moore J, editors. Encyclopedia of animal behavior, vol. 3. San Diego (CA): Elsevier Science; 2010. p. 70–4.
- Fooden J. Systematic review of the rhesus macaque, Macaca mulatta (Zimmermann, 1780). Chicago: Field Museum of Natural History; 2000.
- Riley EP, Wade TW. Adapting to Florida’s riverine woodlands: the population status and feeding ecology of the Silver River rhesus macaques and their interface with humans. Primates. 2016;57:195–210. DOIPubMedGoogle Scholar
- Sha JCM, Gumert MD, Lee BPY-H, Fuentes A, Rajathurai S, Chan S, et al. Status of the long-tailed macaque Macaca fascicularis in Singapore and implications for management. Biodivers Conserv. 2009;18:2909–26. DOIGoogle Scholar
- Aubert M, Chen Z, Lang R, Dang CH, Fowler C, Sloan DD, et al. The antiapoptotic herpes simplex virus glycoprotein J localizes to multiple cellular organelles and induces reactive oxygen species formation. J Virol. 2008;82:617–29. DOIPubMedGoogle Scholar
- Scinicariello F, Eberle R, Hilliard JK. Rapid detection of B virus (herpesvirus simiae) DNA by polymerase chain reaction. J Infect Dis. 1993;168:747–50. DOIPubMedGoogle Scholar
- Reinhardt V. Common husbandry-related variables in biomedical research with animals. Lab Anim. 2004;38:213–35. DOIPubMedGoogle Scholar
- Freifeld AG, Hilliard J, Southers J, Murray M, Savarese B, Schmitt JM, et al. A controlled seroprevalence survey of primate handlers for evidence of asymptomatic herpes B virus infection. J Infect Dis. 1995;171:1031–4. DOIPubMedGoogle Scholar
- Ostrowski SR, Leslie MJ, Parrott T, Abelt S, Piercy PE. B-virus from pet macaque monkeys: an emerging threat in the United States? Emerg Infect Dis. 1998;4:117–21. DOIPubMedGoogle Scholar
- Misra UK, Tan CT, Kalita J. Viral encephalitis and epilepsy. Epilepsia. 2008;49(Suppl 6):13–8. DOIPubMedGoogle Scholar
- Belay ED, Monroe SS. Low-incidence, high-consequence pathogens. Emerg Infect Dis. 2014;20:319–21. DOIPubMedGoogle Scholar