Volume 24, Number 2—February 2018
Research
Macacine Herpesvirus 1 Antibody Prevalence and DNA Shedding among Invasive Rhesus Macaques, Silver Springs State Park, Florida, USA
Table 1
PCR oligonucleotide primers and probe used in the detection of McHV-1 viral DNA in samples from rhesus macaques and soil, Silver Springs State Park, Florida, USA, 2000–2012*
PCR target | Reference | Sequence, 5′ → 3′ |
---|---|---|
gGBV-323F | (21) | TGGCCTACTACCGCGTGG |
gGBV-446R | (21) | TGGTACGTGTGGGAGTCGCG |
gGBV-403T | (21) | (6-FAM)CCGCCCTCTCCGAGCACGTG(BHQ-1) |
DFA | (22) | GAYTTYGCNAGYYTNTAYCC |
ILK | (22) | TCCTGGACAAGCAGCARNYSGCNMTNAA |
KG1 | (22) | GTCTTGCTCACCAGNTCNACNCCYTT |
TGV | (22) | TGTAACTCGGTGTAYGGNTTYACNGGNGT |
IYG | (22) | CACAGAGTCCGTRTCNCCRTADAT |
HB2A | (8) | CCGCGCTCGCCACGGACACCA |
HB2B | (8) | ATCGCGCGCCGGACCGATCGT |
AS9 | (23) | TC[A/T]CCCGGGCTAGACTT[T/C][A/C]TCTTCCTGCTCAG |
AS2 | (23) | ATGGCGGCCAGGGTCAGCGCGCAGAGG |
AS8 | (23) | CTCTGCGCGCTGACCCTGGCCGCCATGG |
AS7 | (23) | CACGTCGGGGGG[G/A]TCCGTCTTCTGCTCC |
*BHQ-1, black hole quencher 1; 6-FAM, 6-fluorescein amidite; gG, glycoprotein G; McHV-1, macacine herpesvirus 1.
References
- Pedersen AB, Davies TJ. Cross-species pathogen transmission and disease emergence in primates. EcoHealth. 2009;6:496–508. DOIPubMedGoogle Scholar
- Kairo M, Ali B, Cheesman O, Haysom K, Murphy S. Invasive species threats in the Caribbean region: report to the Nature Conservancy. Curepe (Trinidad and Tobago): CAB International; 2003.
- Anderson CJ, Hostetler ME, Johnson SA. History and status of introduced non-human primate populations in Florida. Southeast Nat. 2017;16:19–36. DOIGoogle Scholar
- Hannibal DL, Bliss-Moreau E, Vandeleest J, McCowan B, Capitanio J. Laboratory rhesus macaque social housing and social changes: Implications for research. Am J Primatol. 2017;79:1–14. DOIPubMedGoogle Scholar
- Centers for Disease Control and Prevention. B virus (herpes B, monkey B virus, herpesvirus simiae, and herpesvirus B). Atlanta: The Centers; 2016 [cited 2017 Aug 14]. https://www.cdc.gov/herpesbvirus/index.html
- Holmes GP, Chapman LE, Stewart JA, Straus SE, Hilliard JK, Davenport DS; the B Virus Working Group. Guidelines for the prevention and treatment of B-virus infections in exposed persons. The B virus Working Group. Clin Infect Dis. 1995;20:421–39. DOIPubMedGoogle Scholar
- Pellett P, Roizman B. The family Herpesviridae: a brief introduction. In: Knipe D and Howley P, editors. Fields virology, 6th ed. Philadelphia: Lippincott Williams and Wilkins; 2013. p. 1802–2.
- Oya C, Ochiai Y, Taniuchi Y, Takano T, Fujima A, Ueda F, et al. Prevalence of herpes B virus genome in the trigeminal ganglia of seropositive cynomolgus macaques. Lab Anim. 2008;42:99–103. DOIPubMedGoogle Scholar
- Engel GA, Jones-Engel L, Schillaci MA, Suaryana KG, Putra A, Fuentes A, et al. Human exposure to herpesvirus B-seropositive macaques, Bali, Indonesia. Emerg Infect Dis. 2002;8:789–95. DOIPubMedGoogle Scholar
- Jensen K, Alvarado-Ramy F, González-Martínez J, Kraiselburd E, Rullán J. B-virus and free-ranging macaques, Puerto Rico. Emerg Infect Dis. 2004;10:494–6. DOIPubMedGoogle Scholar
- Jones-Engel L, Engel GA, Heidrich J, Chalise M, Poudel N, Viscidi R, et al. Temple monkeys and health implications of commensalism, Kathmandu, Nepal. Emerg Infect Dis. 2006;12:900–6. DOIPubMedGoogle Scholar
- Tischer BK, Osterrieder N. Herpesviruses—a zoonotic threat? Vet Microbiol. 2010;140:266–70. DOIPubMedGoogle Scholar
- Lee MH, Rostal MK, Hughes T, Sitam F, Lee CY, Japning J, et al. Macacine herpesvirus 1 in long-tailed macaques, Malaysia, 2009–2011. Emerg Infect Dis. 2015;21:1107–13. DOIPubMedGoogle Scholar
- Anderson CJ, Hostetler ME, Sieving KE, Johnson SA. Predation of artificial nests by introduced rhesus macaques (Macaca mulatta) in Florida, USA. Biol Invasions. 2016;18:2783–9. DOIGoogle Scholar
- Wolfe LD, Peters EH. History of the freeranging rhesus monkeys (Macaca mulatta) of Silver Springs. Fla Sci. 1987;50:234–45.
- Wolfe LD. Rhesus macaques: a comparative study of two sites, Jaipur, India, and Silver Springs, Florida. In: Fuentes A, Wolfe LD, editors. Primates face to face: the conservation implications of human-nonhuman primate interconnections. Cambridge: Cambridge University Press; 2002. p. 310–30.
- Montague CL, Colwell SV, Percival HF, Gottgens JF. Issues and options related to management of Silver Springs rhesus macaques. Report no. 49. Tallahassee (FL): Florida Game and Fresh Water Fish Commission; 1994.
- Burgos-Rodriguez AG. Zoonotic diseases of primates. Vet Clin North Am Exot Anim Pract. 2011;14:557–75, viii. DOIPubMedGoogle Scholar
- Anderson CJ. Ecology and impacts of introduced non-human primate populations in Florida [dissertation]. Gainesville (FL): University of Florida. In press.
- Weigler BJ. Biology of B virus in macaque and human hosts: a review. Clin Infect Dis. 1992;14:555–67. DOIPubMedGoogle Scholar
- Brown LD, Cai TT, DasGupta A. Interval estimation for a binomial proportion. Stat Sci. 2001;16:101–33. DOIGoogle Scholar
- Perelygina L, Patrusheva I, Manes N, Wildes MJ, Krug P, Hilliard JK. Quantitative real-time PCR for detection of monkey B virus (Cercopithecine herpesvirus 1) in clinical samples. J Virol Methods. 2003;109:245–51. DOIPubMedGoogle Scholar
- VanDevanter DR, Warrener P, Bennett L, Schultz ER, Coulter S, Garber RL, et al. Detection and analysis of diverse herpesviral species by consensus primer PCR. J Clin Microbiol. 1996;34:1666–71.PubMedGoogle Scholar
- Smith AL, Black DH, Eberle R. Molecular evidence for distinct genotypes of monkey B virus (herpesvirus simiae) which are related to the macaque host species. J Virol. 1998;72:9224–32.PubMedGoogle Scholar
- Nei M, Kumar S. Molecular evolution and phylogenetics. New York: Oxford University Press; 2000.
- Weigler BJ, Roberts JA, Hird DW, Lerche NW, Hilliard JK. A cross sectional survey for B virus antibody in a colony of group housed rhesus macaques. Lab Anim Sci. 1990;40:257–61.PubMedGoogle Scholar
- Weigler BJ, Hird DW, Hilliard JK, Lerche NW, Roberts JA, Scott LM, et al. Epidemiology of cercopithecine herpesvirus 1 (B virus) infection and shedding in a large breeding cohort of rhesus macaques. J Infect Dis. 1993;167:257–63. DOIPubMedGoogle Scholar
- Elmore D, Eberle R. Monkey B virus (Cercopithecine herpesvirus 1). Comp Med. 2008;58:11–21.PubMedGoogle Scholar
- Eberle R, Maxwell LK, Nicholson S, Black D, Jones-Engel L. Genome sequence variation among isolates of monkey B virus (Macacine alphaherpesvirus 1) from captive macaques. Virology. 2017;508:26–35. DOIPubMedGoogle Scholar
- Maestripieri D. Rhesus macaques. In: Breed MD and Moore J, editors. Encyclopedia of animal behavior, vol. 3. San Diego (CA): Elsevier Science; 2010. p. 70–4.
- Fooden J. Systematic review of the rhesus macaque, Macaca mulatta (Zimmermann, 1780). Chicago: Field Museum of Natural History; 2000.
- Riley EP, Wade TW. Adapting to Florida’s riverine woodlands: the population status and feeding ecology of the Silver River rhesus macaques and their interface with humans. Primates. 2016;57:195–210. DOIPubMedGoogle Scholar
- Sha JCM, Gumert MD, Lee BPY-H, Fuentes A, Rajathurai S, Chan S, et al. Status of the long-tailed macaque Macaca fascicularis in Singapore and implications for management. Biodivers Conserv. 2009;18:2909–26. DOIGoogle Scholar
- Aubert M, Chen Z, Lang R, Dang CH, Fowler C, Sloan DD, et al. The antiapoptotic herpes simplex virus glycoprotein J localizes to multiple cellular organelles and induces reactive oxygen species formation. J Virol. 2008;82:617–29. DOIPubMedGoogle Scholar
- Scinicariello F, Eberle R, Hilliard JK. Rapid detection of B virus (herpesvirus simiae) DNA by polymerase chain reaction. J Infect Dis. 1993;168:747–50. DOIPubMedGoogle Scholar
- Reinhardt V. Common husbandry-related variables in biomedical research with animals. Lab Anim. 2004;38:213–35. DOIPubMedGoogle Scholar
- Freifeld AG, Hilliard J, Southers J, Murray M, Savarese B, Schmitt JM, et al. A controlled seroprevalence survey of primate handlers for evidence of asymptomatic herpes B virus infection. J Infect Dis. 1995;171:1031–4. DOIPubMedGoogle Scholar
- Ostrowski SR, Leslie MJ, Parrott T, Abelt S, Piercy PE. B-virus from pet macaque monkeys: an emerging threat in the United States? Emerg Infect Dis. 1998;4:117–21. DOIPubMedGoogle Scholar
- Misra UK, Tan CT, Kalita J. Viral encephalitis and epilepsy. Epilepsia. 2008;49(Suppl 6):13–8. DOIPubMedGoogle Scholar
- Belay ED, Monroe SS. Low-incidence, high-consequence pathogens. Emerg Infect Dis. 2014;20:319–21. DOIPubMedGoogle Scholar
Page created: January 17, 2018
Page updated: January 17, 2018
Page reviewed: January 17, 2018
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.