Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link
Volume 24, Number 4—April 2018
Dispatch

Lyssavirus in Japanese Pipistrelle, Taiwan

Shu-Chia Hu, Chao-Lung Hsu, Ming-Shiuh Lee, Yang-Chang Tu, Jen-Chieh Chang, Chieh-Hao Wu, Shu-Hwae Lee, Lu-Jen Ting, Kwok-Rong Tsai, Ming-Chu Cheng, Wen-Jane Tu, and Wei-Cheng HsuComments to Author 
Author affiliations: Animal Health Research Institute, New Taipei City, Taiwan (S.-C. Hu, M.-S. Lee, Y.-C. Tu, J.-C. Chang, C.-H. Wu, L.-J. Ting, K.-R. Tsai, W.-J. Tu, W.-C. Hsu); National Taiwan University, Taipei City, Taiwan (C.-L. Hsu); Bat Conservation Society of Taipei, Taipei City (C.-L. Hsu); Animal Health Research Institute, Miaoli County, Taiwan (S.-H. Lee); National Pingtung University of Science and Technology, Neipu Township, Pingtung County, Taiwan (M.-C. Cheng)

Main Article

Table 1

Lyssavirus screen primers and the 12 amplifying primer sets used to identify Taiwan bat lyssavirus, a putative new lyssavirus found in 2 Japanese pipistrelles (Pipistrellus abramus) in Taiwan in 2016 and 2017

Primer name Sequence, 5′ → 3′ Position*
Lyssavirus screen
JW12 (7) ATGTAACACCYCTACAATG
N165–146 (7) GCAGGGTAYTTRTACTCATA
N113F (8) GTAGGATGCTATATGGG
N304R (9)
TTGACGAAGATCTTGCTCAT

Lyssavirus full genome
TWBLV 1F ACGCTTAACGACAAAAYC 1–18*
TWBLV 1R TCTTGCATTTCTTTCTCATC 1154–1173
TWBLV 2F TTCGTAGGATGTTACATGGG 1010–1029
TWBLV 2R taaaaatatcccagaagatc 2174–2193
TWBLV 3F AGARATAGCWCATCAGATWGC 2118–2138
TWBLV 3R CTATTGTGTGGCACCATWAC 3205–3224
TWBLV 4F GATGAGGATAAGAACACATC 3072–3091
TWBLV 4R TCCTGAAGTGACTGAGTTTTC 4274–4294
TWBLV 5F CTGATGGAYGGRTCATGGGT 4081–4100
TWBLV 5R GAGACAGGAGCCGGAGTCTT 5280–5299
TWBLV 6F AACAGGTAGCTCCCGAGTTTGTTC 4881–4904
TWBLV 6R CTGAGTGAGACCCATGTATCCAAA 5767–5790
TWBLV 7F ACTGAGGTTTATGATGACCC 5478–5497
TWBLV 7R CCCCAGTGTCTATARCAWCC 6561–6580
TWBLV 8F CATTCTTTGGGGGATTTCCC 6426–6445
TWBLV 8R GTTTGTGATTCTCTRTCWATC 7595–7615
TWBLV 9F CATGCTGGAACGGTCAGGAYG 7522–7542
TWBLV 9R CTGAGTTAAAGAAAGATTCTT 8662–8682
TWBLV 10F CTCAGTGAGTTRTTYAGCTC 8547–8566
TWBLV 10R CAGATAGAAGAGCCTATT 9746–9763
TWBLV 11F CATGATTCAGGGTAYAAYGA 9648–9667
TWBLV 11R GTCTGTAACTTCTGCATCAC 10862–10871
TWBLV 12F ATCTGGGAAAAGCCATCAGA 10755–10774
TWBLV 12R ACGCTTAACAAAAAAAACAA 11961–11980

*Compared with reference genomic sequence, Irkut lyssavirus (GenBank accession no. NC020809). TWBLV, Taiwan bat lyssavirus.

Main Article

References
  1. Kuzmin  IV. Basic facts about lyssavirus. In: Rupprecht CE, Nagarajan T, editor. Current laboratory techniques in rabies diagnosis, research, and prevention, volume 1. Laguna Hills (CA): Elsevier; 2014. p. 3–17.
  2. Aréchiga Ceballos  N, Vázquez Morón  S, Berciano  JM, Nicolás  O, Aznar López  C, Juste  J, et al. Novel lyssavirus in bat, Spain. Emerg Infect Dis. 2013;19:7935. DOIPubMed
  3. Gunawardena  PS, Marston  DA, Ellis  RJ, Wise  EL, Karawita  AC, Breed  AC, et al. Lyssavirus in Indian flying foxes, Sri Lanka. Emerg Infect Dis. 2016;22:14569. DOIPubMed
  4. Banyard  AC, Evans  JS, Luo  TR, Fooks  AR. Lyssaviruses and bats: emergence and zoonotic threat. Viruses. 2014;6:297490. DOIPubMed
  5. Kuzmin  IV, Orciari  LA, Arai  YT, Smith  JS, Hanlon  CA, Kameoka  Y, et al. Bat lyssaviruses (Aravan and Khujand) from Central Asia: phylogenetic relationships according to N, P and G gene sequences. Virus Res. 2003;97:6579. DOIPubMed
  6. Liu  Y, Zhang  S, Zhao  J, Zhang  F, Hu  R. Isolation of Irkut virus from a Murina leucogaster bat in China. PLoS Negl Trop Dis. 2013;7:e2097. DOIPubMed
  7. Hayman  DT, Banyard  AC, Wakeley  PR, Harkess  G, Marston  D, Wood  JL, et al. A universal real-time assay for the detection of lyssaviruses. J Virol Methods. 2011;177:8793. DOIPubMed
  8. Franka  R, Constantine  DG, Kuzmin  I, Velasco-Villa  A, Reeder  SA, Streicker  D, et al. A new phylogenetic lineage of rabies virus associated with western pipistrelle bats (Pipistrellus hesperus). J Gen Virol. 2006;87:230921. DOIPubMed
  9. Trimarchi  CV, Smith  JS. Diagnostic evaluation. In: Press A, Jackson AC, Wunner WH, editors. Rabies. 1st ed. San Diego (CA): Academic Press; 2002. p. 308–44.
  10. Mayer  F, von Helversen  O. Cryptic diversity in European bats. Proc Biol Sci. 2001;268:182532. DOIPubMed
  11. Bozzola  JJ, Russell  LD. Electron microscopy: principles and techniques for biologists. Burlington (MA): Jones & Bartlett Learning; 1992. p. 130–134.
  12. World Health Organization. WHO Expert Consultation on Rabies. Second report. World Health Organ Tech Rep Ser. 2013;982:1139.PubMed
  13. Francis  CM. Chiroptera In: Mayer K, editor. A field guide to the mammals of South-East Asia, 1st ed. London: New Holland; 2008. p. 238.
  14. Srinivasulu  B, Srinivasulu  C, Kaur  H, Srinivasulu  A. A new distribution record of the Japanese pipistrelle (Pipistrellus abramus (Temminck, 1840); Mammalia, Chiroptera) in India. Acta Zoologica Lituanica. 2011;21:26872. DOI

Main Article

Page created: March 19, 2018
Page updated: March 19, 2018
Page reviewed: March 19, 2018
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external