Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link
Volume 25, Number 1—January 2019
Research

Multiple Introductions of Domestic Cat Feline Leukemia Virus in Endangered Florida Panthers1

Elliott S. Chiu, Simona Kraberger, Mark Cunningham, Lara Cusack, Melody Roelke, and Sue VandeWoudeComments to Author 
Author affiliations: Colorado State University, Fort Collins, Colorado, USA (E.S. Chiu, S. Kraberger, S. VandeWoude); Florida Fish and Wildlife Conservation Commission, Gainesville, Florida, USA (M. Cunningham, L. Cusack); National Institutes of Health, Bethesda, Maryland, USA (M. Roelke)

Main Article

Table 2

Primer sequences used for PCR testing of each species and locus for FeLV*

Region Sequence, 5′ → 3′ Species Cycling conditions or reference
Full genome (first half) 95°C for 3 min; 30 cycles at 98°C for 20 s; 60°C for 15 s; 72°C for 2 min 40 s; 72°C for 2 min 40 s
Forward TGAAAGACCCCCTACCCCAAAATTTAGCC Puma concolor coryi/Felis catus
Reverse
 GCGGGTCCATTATCTGAACCCAATACC
 P. concolor coryi/F. catus
Full genome (second half)
Forward GAGTTCCTTGGAACTGCAGGTTACTGCC P. concolor coryi/F. catus
Reverse TGAAAGACCCCTGAACTAGGTCTTCCTCG P. concolor coryi
Reverse 2
 GCTGGCAGTGGCCTTGAAACTTCTG
 F. catus
FeLV-B env (28)
Forward CAGATCAGGAACCATTCCCAGG P. concolor coryi
Reverse
 CCTCTAACTTCCTTGTATCTCATGG
 P. concolor coryi
LTR-gag
Forward CGCAACCCTGGAAGACGTTCCA P. concolor coryi/F. catus 95°C for 3 min; 30 cycles at 98°C for 20 s; 60°C for 15 s; 72°C for 15 s; 72°C for 30 s
Reverse TCGTCTCCGATCAACACCCTGTATTCA P. concolor coryi/F. catus
gag
Forward GGACCTTATGGACACCCCGACCAA P. concolor coryi/F. catus
Reverse GGAGGGGGTAGGAACGGACGAA P. concolor coryi/F. catus
env
Forward CCTTTTACGTCTGCCCAGGGCAT P. concolor coryi/F. catus
Reverse TTCCACCAAGCTTCTCCTGTGGTCT P. concolor coryi/F. catus

*The first half-genome primer set for FeLV sequencing (F/5.2R) spanning 5′-LTR/3′-pol was the same for the FeLV-positive Florida panthers and domestic cats. Reverse half-genome primers were designed to avoid amplification of domestic cat enFeLV and therefore differed for Florida panthers and domestic cats. FeLV, feline leukemia virus.

Main Article

References
  1. Willett  BJ, Hosie  MJ. Feline leukaemia virus: half a century since its discovery. Vet J. 2013;195:16–23. DOIPubMedGoogle Scholar
  2. Jarrett  O, Russell  PH. Differential growth and transmission in cats of feline leukaemia viruses of subgroups A and B. Int J Cancer. 1978;21:466–72. DOIPubMedGoogle Scholar
  3. Chiu  ES, Hoover  EA, VandeWoude  S. A retrospective examination of feline leukemia subgroup characterization: viral interference assays to deep sequencing. Viruses. 2018;10:E29. DOIPubMedGoogle Scholar
  4. Mackey  L, Jarrett  W, Jarrett  O, Laird  H. Anemia associated with feline leukemia virus infection in cats. J Natl Cancer Inst. 1975;54:209–17. DOIPubMedGoogle Scholar
  5. Mullins  JI, Hoover  EA, Overbaugh  J, Quackenbush  SL, Donahue  PR, Poss  ML. FeLV-FAIDS-induced immunodeficiency syndrome in cats. Vet Immunol Immunopathol. 1989;21:25–37. DOIPubMedGoogle Scholar
  6. Hartmann  K. Clinical aspects of feline retroviruses: a review. Viruses. 2012;4:2684–710. DOIPubMedGoogle Scholar
  7. Stewart  MA, Warnock  M, Wheeler  A, Wilkie  N, Mullins  JI, Onions  DE, et al. Nucleotide sequences of a feline leukemia virus subgroup A envelope gene and long terminal repeat and evidence for the recombinational origin of subgroup B viruses. J Virol. 1986;58:825–34.PubMedGoogle Scholar
  8. O’Hara  B, Johann  SV, Klinger  HP, Blair  DG, Rubinson  H, Dunn  KJ, et al. Characterization of a human gene conferring sensitivity to infection by gibbon ape leukemia virus. Cell Growth Differ. 1990;1:119–27.PubMedGoogle Scholar
  9. Takeuchi  Y, Vile  RG, Simpson  G, O’Hara  B, Collins  MK, Weiss  RA. Feline leukemia virus subgroup B uses the same cell surface receptor as gibbon ape leukemia virus. J Virol. 1992;66:1219–22.PubMedGoogle Scholar
  10. Roy-Burman  P. Endogenous env elements: partners in generation of pathogenic feline leukemia viruses. Virus Genes. 1995;11:147–61. DOIPubMedGoogle Scholar
  11. Hoover  EA, Mullins  JI. Feline leukemia virus infection and diseases. J Am Vet Med Assoc. 1991;199:1287–97.PubMedGoogle Scholar
  12. Stewart  H, Jarrett  O, Hosie  MJ, Willett  BJ. Complete genome sequences of two feline leukemia virus subgroup B isolates with novel recombination sites. Genome Announc. 2013;1:e00036–12. DOIPubMedGoogle Scholar
  13. Yilmaz  H, Ilgaz  A, Harbour  DA. Prevalence of FIV and FeLV infections in cats in Istanbul. J Feline Med Surg. 2000;2:69–70. DOIPubMedGoogle Scholar
  14. Muirden  A. Prevalence of feline leukaemia virus and antibodies to feline immunodeficiency virus and feline coronavirus in stray cats sent to an RSPCA hospital. Vet Rec. 2002;150:621–5. DOIPubMedGoogle Scholar
  15. Bandecchi  P, Dell’Omodarme  M, Magi  M, Palamidessi  A, Prati  MC. Feline leukaemia virus (FeLV) and feline immunodeficiency virus infections in cats in the Pisa district of Tuscany, and attempts to control FeLV infection in a colony of domestic cats by vaccination. Vet Rec. 2006;158:555–7. DOIPubMedGoogle Scholar
  16. Gleich  SE, Krieger  S, Hartmann  K. Prevalence of feline immunodeficiency virus and feline leukaemia virus among client-owned cats and risk factors for infection in Germany. J Feline Med Surg. 2009;11:985–92. DOIPubMedGoogle Scholar
  17. Sleeman  JM, Keane  JM, Johnson  JS, Brown  RJ, Woude  SV. Feline leukemia virus in a captive bobcat. J Wildl Dis. 2001;37:194–200. DOIPubMedGoogle Scholar
  18. Luaces  I, Doménech  A, García-Montijano  M, Collado  VM, Sánchez  C, Tejerizo  JG, et al. Detection of Feline leukemia virus in the endangered Iberian lynx (Lynx pardinus). J Vet Diagn Invest. 2008;20:381–5. DOIPubMedGoogle Scholar
  19. Cunningham  MW, Brown  MA, Shindle  DB, Terrell  SP, Hayes  KA, Ferree  BC, et al. Epizootiology and management of feline leukemia virus in the Florida puma. J Wildl Dis. 2008;44:537–52. DOIPubMedGoogle Scholar
  20. Filoni  C, Catão-Dias  JL, Cattori  V, Willi  B, Meli  ML, Corrêa  SH, et al. Surveillance using serological and molecular methods for the detection of infectious agents in captive Brazilian neotropic and exotic felids. J Vet Diagn Invest. 2012;24:166–73. DOIPubMedGoogle Scholar
  21. Silva  CP, Onuma  SS, de Aguiar  DM, Dutra  V, Nakazato  L. Molecular detection of Feline Leukemia Virus in free-ranging jaguars (Panthera onca) in the Pantanal region of Mato Grosso, Brazil. Braz J Infect Dis. 2016;20:316–7. DOIPubMedGoogle Scholar
  22. Polani  S, Roca  AL, Rosensteel  BB, Kolokotronis  SO, Bar-Gal  GK. Evolutionary dynamics of endogenous feline leukemia virus proliferation among species of the domestic cat lineage. Virology. 2010;405:397–407. DOIPubMedGoogle Scholar
  23. Meli  ML, Cattori  V, Martínez  F, López  G, Vargas  A, Simón  MA, et al. Feline leukemia virus and other pathogens as important threats to the survival of the critically endangered Iberian lynx (Lynx pardinus). PLoS One. 2009;4:e4744. DOIPubMedGoogle Scholar
  24. Brown  MA, Cunningham  MW, Roca  AL, Troyer  JL, Johnson  WE, O’Brien  SJ. Genetic characterization of feline leukemia virus from Florida panthers. Emerg Infect Dis. 2008;14:252–9. DOIPubMedGoogle Scholar
  25. Newcombe  RG. Two-sided confidence intervals for the single proportion: comparison of seven methods. Stat Med. 1998;17:857–72. DOIPubMedGoogle Scholar
  26. Fan  H, Gulley  ML. DNA extraction from fresh or frozen tissues. In: Killeen AA, editor. Molecular pathology protocols. Totowa (NJ): Humana Press Inc.; 2001. p. 5–10.
  27. Carver  S, Bevins  SN, Lappin  MR, Boydston  EE, Lyren  LM, Alldredge  M, et al. Pathogen exposure varies widely among sympatric populations of wild and domestic felids across the United States. Ecol Appl. 2016;26:367–81. DOIPubMedGoogle Scholar
  28. Powers  JA, Chiu  ES, Kraberger  SJ, Roelke-Parker  M, Lowery  I, Erbeck  K, et al. Feline leukemia virus disease outcomes in a domestic cat breeding colony: relationship to endogenous FeLV and other chronic viral infections. J Virol. 2018;92:e00649–18. DOIPubMedGoogle Scholar
  29. Chandhasin  C, Coan  PN, Pandrea  I, Grant  CK, Lobelle-Rich  PA, Puetter  A, et al. Unique long terminal repeat and surface glycoprotein gene sequences of feline leukemia virus as determinants of disease outcome. J Virol. 2005;79:5278–87. DOIPubMedGoogle Scholar
  30. Benson  DA, Cavanaugh  M, Clark  K, Karsch-Mizrachi  I, Lipman  DJ, Ostell  J, et al. GenBank. Nucleic Acids Res. 2013;41(D1):D36–42. DOIPubMedGoogle Scholar
  31. Muhire  BM, Varsani  A, Martin  DP. SDT: a virus classification tool based on pairwise sequence alignment and identity calculation. PLoS One. 2014;9:e108277. DOIPubMedGoogle Scholar
  32. Edgar  RC. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 2004;32:1792–7. DOIPubMedGoogle Scholar
  33. Tamura  K, Peterson  D, Peterson  N, Stecher  G, Nei  M, Kumar  S. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol. 2011;28:2731–9. DOIPubMedGoogle Scholar
  34. Posada  D. Selection of models of DNA evolution with jModelTest. Totowa (NJ): Humana Press Inc; 2009.
  35. Guindon  S, Dufayard  J-F, Lefort  V, Anisimova  M, Hordijk  W, Gascuel  O. New algorithms and methods to estimate maximum-likelihood phylogenies: assessing the performance of PhyML 3.0. Syst Biol. 2010;59:307–21. DOIPubMedGoogle Scholar
  36. Tavaré  S. Some probabilistic and statistical problems in the analysis of DNA sequences. Lect Math Life Sci. 1986;17:57–86.
  37. Kimura  M. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J Mol Evol. 1980;16:111–20. DOIPubMedGoogle Scholar
  38. Jukes  TH, Cantor  CR. Evolution of protein molecules. New York: Academic Press; 1969.
  39. Roelke  ME, Forrester  DJ, Jacobson  ER, Kollias  GV, Scott  FW, Barr  MC, et al. Seroprevalence of infectious disease agents in free-ranging Florida panthers (Felis concolor coryi). J Wildl Dis. 1993;29:36–49. DOIPubMedGoogle Scholar
  40. Lee  IT, Levy  JK, Gorman  SP, Crawford  PC, Slater  MR. Prevalence of feline leukemia virus infection and serum antibodies against feline immunodeficiency virus in unowned free-roaming cats. J Am Vet Med Assoc. 2002;220:620–2. DOIPubMedGoogle Scholar
  41. Aguilar  GD, Farnworth  MJ. Distribution characteristics of unmanaged cat colonies over a 20 year period in Auckland, New Zealand. Appl Geogr. 2013;37:160–7. DOIGoogle Scholar
  42. Jarrett  O, Hardy  WD Jr, Golder  MC, Hay  D. The frequency of occurrence of feline leukaemia virus subgroups in cats. Int J Cancer. 1978;21:334–7. DOIPubMedGoogle Scholar
  43. Stewart  H, Jarrett  O, Hosie  MJ, Willett  BJ. Are endogenous feline leukemia viruses really endogenous? Vet Immunol Immunopathol. 2011;143:325–31. DOIPubMedGoogle Scholar
  44. Rojko  JL, Olsen  RG. The immunobiology of the feline leukemia virus. Vet Immunol Immunopathol. 1984;6:107–65. DOIPubMedGoogle Scholar
  45. Tzavaras  T, Stewart  M, McDougall  A, Fulton  R, Testa  N, Onions  DE, et al. Molecular cloning and characterization of a defective recombinant feline leukaemia virus associated with myeloid leukaemia. J Gen Virol. 1990;71:343–54. DOIPubMedGoogle Scholar
  46. Löber  U, Hobbs  M, Dayaram  A, Tsangaras  K, Jones  K, Alquezar-Planas  DE, et al. Degradation and remobilization of endogenous retroviruses by recombination during the earliest stages of a germ-line invasion. Proc Natl Acad Sci U S A. 2018;115:8609–14. DOIPubMedGoogle Scholar
  47. Ávila-Arcos  MC, Ho  SY, Ishida  Y, Nikolaidis  N, Tsangaras  K, Hönig  K, et al. One hundred twenty years of koala retrovirus evolution determined from museum skins. Mol Biol Evol. 2013;30:299–304. DOIPubMedGoogle Scholar
  48. Tarlinton  R, Meers  J, Hanger  J, Young  P. Real-time reverse transcriptase PCR for the endogenous koala retrovirus reveals an association between plasma viral load and neoplastic disease in koalas. J Gen Virol. 2005;86:783–7. DOIPubMedGoogle Scholar
  49. Moss  WE, Alldredge  MW, Logan  KA, Pauli  JN. Human expansion precipitates niche expansion for an opportunistic apex predator (Puma concolor). Sci Rep. 2016;6:39639. DOIPubMedGoogle Scholar

Main Article

1Preliminary results from this study were presented at the Ecology and Evolution of Infectious Diseases Conference, June 24–27, 2017, Santa Barbara, California, USA.

Page created: December 18, 2018
Page updated: December 18, 2018
Page reviewed: December 18, 2018
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external