Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link

Volume 25, Number 7—July 2019

Research

High-Complexity Plasmodium falciparum Infections, North Central Nigeria, 2015–2018

Bitrus YakubuComments to Author , Ishaya Yohanna Longdet, Horsfall Jen Tony, Dinchi Tyem Davou, and Emmanuel Obishakin
Author affiliations: National Veterinary Research Institute Vom, Jos, Nigeria (B. Yakubu, D.T. Davou, E. Obishakin); University of Jos, Jos (I.Y. Longdet, H.J. Tony)

Main Article

Table 1

Primer sequences used for PCRs to screen and genotype samples collected in study of genetic diversity of Plasmodium falciparum parasites, North Central Nigeria, 2015–2018*

PCR description Primer name or type: sequence, 5′→3′ Size, bp Reference
Nest-1
rPLU1: TCAAAGATTAAGCCATGCAAGTGA 620
(27)
rPLU5: CCTGTTGTTGCCTTAAACTCC
Nest-2, genus-specific PCR
rPLU3: TTTTTATAAGGATAACTACGGAAAAGCTGT 240
(27)
rPLU4: TACCCGTCATAGCCATGTTAGGCCAATACC
Plasmodium falciparum species–specific PCR
rFAL1: TTAAACTGGTTTGGGAAAACCAAATATATT 205
(27)
rFAL2: ACACAATGAACTCAATCATGACTACCCGTC
msp1, primary reaction
Forward: CTAGAAGCTTTAGAAGATGCAGTATTG Variable
(28)
Reverse: CTTAAATAGTATTCTAATTCAAGTGGATCA
K1
Forward: AAATGAAGAAGAAATTACTACAAAAGGTGC Variable
(28)
Reverse: GCTTGCATCAGCTGGAGGGCTTGCACCAGA
MAD20
Forward: AAATGAAGGAACAAGTGGAACAGCTGTTAC Variable
(28)
Reverse: ATCTGAAGGATTTGTACGTCTTGAATTACC
RO33
Forward: TAAAGGATGGAGCAAATACTCAAGTTGTTG Variable
(28)
Reverse: CATCTGAAGGATTTGCAGCACCTGGAGATC
msp2, primary reaction
Forward: ATGAAGGTAATTAAAACATTGTCTATTATA Variable
(28)
Reverse: CTTTGTTACCATCGGTACATTCTT
FC27
Forward: AATACTAAGAGTGTAGGTGCARATGCTCCA Variable
(28)
Reverse: TTTTATTTGGTGCATTGCCAGAACTTGAAC
IC/3D7
Forward: AGAAGTATGGCAGAAAGTAAKCCTYCTACT Variable
(28)
Reverse: GATTGTAATTCGGGGGATTCAGTTTGTTCG
glurp, primary reaction
Forward: TGAATTTGAAGATGTTCACACTGAAC Variable
(28)
Reverse: GTGGAATTGCTTTTTCTTCAACACTAA
glurp Forward: TGTTCACACTGAACAATTAGATTTAGATCA Variable (28)
Reverse: GTGGAATTGCTTTTTCTTCAACACTAA

*glurp, glutamate-rich protein; msp1, merozoite surface protein 1; msp2, merozoite surface protein 2.

Main Article

References
  1. National Malaria Elimination Programme, National Population Commission, and National Bureau of Statistics, Federal Republic of Nigeria; ICT International. Nigeria malaria indicator survey 2015. 2016 Aug [cited 2018 Oct 18]. https://dhsprogram.com/pubs/pdf/MIS20/MIS20.pdf
  2. World Health Organization. World malaria report 2017. Geneva: The Organization; 2017 [cited 2018 Oct 18]. https://www.who.int/malaria/publications/world-malaria-report-2017
  3. United Nations Office for the Coordination of Humanitarian Affairs. Situation report no.1, 2014. 2014 [cited 2018 Oct 18]. http://www.unocha.org/nigeria
  4. Aribodor  DN, Ugwuanyi  IK, Aribodor  OB. Challenges to achieving malaria elimination in Nigeria. Am J Public Health Res. 2016;4:38–41.
  5. Internal Displacement Monitoring Centre. GRID 2016. Global report on internal displacement. 2016 May [cited 2018 Oct 18]. http://www.internal-displacement.org/globalreport2016
  6. Emmanuelar  I. Insurgency and humanitarian crisis in northern Nigeria: the case of Boko Haram. Afr J Pol Sci Int Relat. 2015;9:284–96. DOIGoogle Scholar
  7. Martens  P, Hall  L. Malaria on the move: human population movement and malaria transmission. Emerg Infect Dis. 2000;6:103–9. DOIPubMedGoogle Scholar
  8. Greenwood  B, Mutabingwa  T. Malaria in 2002. Nature. 2002;415:670–2. DOIPubMedGoogle Scholar
  9. Gu  W, Killeen  GF, Mbogo  CM, Regens  JL, Githure  JI, Beier  JC. An individual-based model of Plasmodium falciparum malaria transmission on the coast of Kenya. Trans R Soc Trop Med Hyg. 2003;97:43–50. DOIPubMedGoogle Scholar
  10. Osorio  L, Todd  J, Pearce  R, Bradley  DJ. The role of imported cases in the epidemiology of urban Plasmodium falciparum malaria in Quibdó, Colombia. Trop Med Int Health. 2007;12:331–41. DOIPubMedGoogle Scholar
  11. Conway  DJ, Roper  C, Oduola  AMJ, Arnot  DE, Kremsner  PG, Grobusch  MP, et al. High recombination rate in natural populations of Plasmodium falciparum. Proc Natl Acad Sci U S A. 1999;96:4506–11. DOIPubMedGoogle Scholar
  12. Meyer  CG, May  J, Arez  AP, Gil  JP, Do Rosario  V. Genetic diversity of Plasmodium falciparum: asexual stages. Trop Med Int Health. 2002;7:395–408. DOIPubMedGoogle Scholar
  13. Kiwanuka  GN. Genetic diversity in Plasmodium falciparum merozoite surface protein 1 and 2 coding genes and its implications in malaria epidemiology: a review of published studies from 1997-2007. J Vector Borne Dis. 2009;46:1–12.PubMedGoogle Scholar
  14. Lee  SA, Yeka  A, Nsobya  SL, Dokomajilar  C, Rosenthal  PJ, Talisuna  A, et al. Complexity of Plasmodium falciparum infections and antimalarial drug efficacy at 7 sites in Uganda. J Infect Dis. 2006;193:1160–3. DOIPubMedGoogle Scholar
  15. Kyabayinze  DJ, Karamagi  C, Kiggundu  M, Kamya  MR, Wabwire-Mangen  F, Kironde  F, et al. Multiplicity of Plasmodium falciparum infection predicts antimalarial treatment outcome in Ugandan children. Afr Health Sci. 2008;8:200–5.PubMedGoogle Scholar
  16. Amodu  OK, Adeyemo  AA, Ayoola  OO, Gbadegesin  RA, Orimadegun  AE, Akinsola  AK, et al. Genetic diversity of the msp-1 locus and symptomatic malaria in south-west Nigeria. Acta Trop. 2005;95:226–32. DOIPubMedGoogle Scholar
  17. Amodu  OK, Oyedeji  SI, Ntoumi  F, Orimadegun  AE, Gbadegesin  RA, Olumese  PE, et al. Complexity of the msp2 locus and the severity of childhood malaria, in south-western Nigeria. Ann Trop Med Parasitol. 2008;102:95–102. DOIPubMedGoogle Scholar
  18. Ajayi  NA, Ukwaja  KN. Possible artemisinin-based combination therapy-resistant malaria in Nigeria: a report of three cases. Rev Soc Bras Med Trop. 2013;46:525–7. DOIPubMedGoogle Scholar
  19. Ferreira  MU, Kaneko  O, Kimura  M, Liu  Q, Kawamoto  F, Tanabe  K. Allelic diversity at the merozoite surface protein-1 (MSP-1) locus in natural Plasmodium falciparum populations: a brief overview. Mem Inst Oswaldo Cruz. 1998;93:631–8. DOIPubMedGoogle Scholar
  20. Ferreira  MU, Ribeiro  WL, Tonon  AP, Kawamoto  F, Rich  SM. Sequence diversity and evolution of the malaria vaccine candidate merozoite surface protein-1 (MSP-1) of Plasmodium falciparum. Gene. 2003;304:65–75. DOIPubMedGoogle Scholar
  21. Mwingira  F, Nkwengulila  G, Schoepflin  S, Sumari  D, Beck  H-P, Snounou  G, et al. Plasmodium falciparum msp1, msp2 and glurp allele frequency and diversity in sub-Saharan Africa. Malar J. 2011;10:79. DOIPubMedGoogle Scholar
  22. Manske  M, Miotto  O, Campino  S, Auburn  S, Almagro-Garcia  J, Maslen  G, et al. Analysis of Plasmodium falciparum diversity in natural infections by deep sequencing. Nature. 2012;487:375–9. DOIPubMedGoogle Scholar
  23. Irawati  N, Jamsari , Wirasti  Y. Genetic diversity of merozoite surface protein-1 in Plasmodium falciparum field isolates from a mountain and coastal area in West Sumatera, Indonesia. J Pharm Biomed Sci. 2013;30:1061–4.
  24. Mawili-Mboumba  DP, Mbondoukwe  N, Adande  E, Bouyou-Akotet  MK. Allelic diversity of msp1 gene in Plasmodium falciparum from rural and urban areas of Gabon. Korean J Parasitol. 2015;53:413–9. DOIPubMedGoogle Scholar
  25. Jelinek  T, Kilian  AH, Westermeier  A, Pröll  S, Kabagambe  G, Nothdurft  HD, et al. Population structure of recrudescent Plasmodium falciparum isolates from western Uganda. Trop Med Int Health. 1999;4:476–80. DOIPubMedGoogle Scholar
  26. Snounou  G, Viriyakosol  S, Zhu  XP, Jarra  W, Pinheiro  L, do Rosario  VE, et al. High sensitivity of detection of human malaria parasites by the use of nested polymerase chain reaction. Mol Biochem Parasitol. 1993;61:315–20. DOIPubMedGoogle Scholar
  27. Singh  B, Bobogare  A, Cox-Singh  J, Snounou  G, Abdullah  MS, Rahman  HA. A genus- and species-specific nested polymerase chain reaction malaria detection assay for epidemiologic studies. Am J Trop Med Hyg. 1999;60:687–92. DOIPubMedGoogle Scholar
  28. Snounou  G, Fӓrnert  A. Genotyping of Plasmodium falciparum parasites by PCR. In: Moll K, Ljungstrӧm I, Perlmann H, Scherf A, Wahlgren M, editors. Methods in malaria research. Manassas (VA): American Type Culture Collection; 2008. p. 238–42 [cited 2018 Oct 18]. https://ki.se/sites/default/files/methods_in_malaria_research.pdf
  29. Waters  AP, McCutchan  TF. Rapid, sensitive diagnosis of malaria based on ribosomal RNA. Lancet. 1989;1:1343–6. DOIPubMedGoogle Scholar
  30. Happi  CT, Gbotosho  GO, Sowunmi  A, Falade  CO, Akinboye  DO, Gerena  L, et al. Molecular analysis of Plasmodium falciparum recrudescent malaria infections in children treated with chloroquine in Nigeria. Am J Trop Med Hyg. 2004;70:20–6. DOIPubMedGoogle Scholar
  31. Olasehinde  GI, Yah  CS, Singh  R, Ojuronbge  OO, Ajayi  AA, Valecha  N, et al. Genetic diversity of Plasmodium falciparum field isolates from south western Nigeria. Afr Health Sci. 2012;12:355–61.PubMedGoogle Scholar
  32. Oyebola  MK, Idowu  ET, Olukosi  YA, Iwalokun  BA, Agomo  CO, Ajibaye  OO, et al. Genetic diversity and complexity of Plasmodium falciparum infections in Lagos, Nigeria. Asian Pac J Trop Biomed. 2014;4(Suppl 1):S87–91. DOIPubMedGoogle Scholar
  33. Bamidele Abiodun  I, Oluwadun  A, Olugbenga Ayoola  A, Senapon Olusola  I. Plasmodium falciparum merozoite surface proein-1 polymorphisms among asymptomatic sickle cell anemia patients in Nigeria. Acta Med Iran. 2016;54:44–53.PubMedGoogle Scholar
  34. Sam Wobo  SO, Adekunle  NO, Adeleke  MA, Dedeke  GA, Oke  OA, Abimbola  WA, et al. Epidemiological factors in prevalence of malaria parasites in primary health facilities attendants, Ogun State, Nigeria. Malar Chemother Control Elimin. 2014;3:1000111.
  35. Cui  L, Mharakurwa  S, Ndiaye  D, Rathod  PK, Rosenthal  PJ. Antimalarial drug resistance: literature review and activities and findings of the ICEMR network. Am J Trop Med Hyg. 2015;93(Suppl):57–68. DOIPubMedGoogle Scholar
  36. Oboh  MA, Ndiaye  D, Antony  HA, Badiane  AS, Singh  US, Ali  NA, et al. Status of artemisinin resistance in malaria parasite Plasmodium falciparum from molecular analysis of kelch13 gene in southwestern Nigeria. BioMed Res Int. 2018;2018:2305062. DOIPubMedGoogle Scholar
  37. Ebenebe  JC, Ntadom  G, Ambe  J, Wammanda  R, Jiya  N, Finomo  F, et al.; For The Antimalarial Therapeutic Efficacy Monitoring Group National Malaria Elimination Programme The Federal Ministry Of Health Abuja Nigeria. Efficacy of artemisinin-based combination treatments of uncomplicated falciparum malaria in under-five year-old Nigerian children ten years following adoption as first line antimalarials. Am J Trop Med Hyg. 2018;99:649–64. DOIPubMedGoogle Scholar
  38. Flannery  EL, Wang  T, Akbari  A, Corey  VC, Gunawan  F, Bright  AT, et al. Next-generation sequencing of Plasmodium vivax patient sample shows evidence of direct evolution in drug-resistance genes. ACS Infect Dis. 2015;1:367–79. DOIPubMedGoogle Scholar
  39. Nag  S, Dalgaard  MD, Kofoed  PE, Ursing  J, Crespo  M, Andersen  LO, et al. High throughput resistance profiling of Plasmodium falciparum infections based on custom dual indexing and Illumina next generation sequencing-technology. Sci Rep. 2017;7:2398. DOIPubMedGoogle Scholar
  40. International Organization for Migration. Displacement tracking matrix (DTM) round 12 report-October 2016. 2016 Oct [cited 2018 Oct 18]. https://reliefweb.int/report/nigeria/displacement-tracking-matrix-dtm-round-12-report-october-2016
  41. International Committee of the Red Cross. Internal displacement in northeastern Nigeria. Kampala Convention. Supra note 6. Article 5(1). 2016 Dec [cited 2018 Oct 18]. http://www.icrc.org/where-we-work/africa/nigeria
  42. Oyedeji  SI, Awobode  HO, Anumudu  C, Kun  J. Genetic diversity of Plasmodium falciparum isolates from naturally infected children in north-central Nigeria using the merozoite surface protein-2 as molecular marker. Asian Pac J Trop Med. 2013;6:589–94. DOIPubMedGoogle Scholar

Main Article

Page created: August 19, 2019
Page updated: August 19, 2019
Page reviewed: August 19, 2019
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external