Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link

Volume 26, Number 9—September 2020

Dispatch

Identification of Streptococcus suis Meningitis by Direct Triplex Real-Time PCR, Burkina Faso

Mahamoudou OuattaraComments to Author , Mamadou Tamboura, Dinanibe Kambire, Mahamoudou Sanou, Kalifa Ouattara, Malika Congo, Adama Kaboré, Soufiane Sanou, Elie Kabré, Sable Sharpley, Theresa Tran, Stephanie Schwartz, Soumeya Ouangraoua, Abdoul-salam Ouedraogo, Lassana Sangaré, Rasmata Ouedraogo-Traore, Cynthia G. Whitney, and Bernard Beall
Author affiliations: Centers for Disease Control and Prevention, Atlanta, Georgia, USA (M. Ouattara, S. Sharpley, T. Tran, S. Schwartz, C.G. Whitney, B. Beall); Centre Hospitalier Universitaire Pédiatrique Charles de Gaulle, Ouagadougou, Burkina Faso (M. Tamboura, D. Kambire, M. Sanou, R. Ouedraogo-Traore); Centre Hospitalier Universitaire Yalgado Ouédraogo, Ouagadougou (K. Ouattara, M. Congo, L. Sangaré); Centre Hospitalier Universitaire Sanon-Sourô, Bobo-Dioulasso, Burkina Faso (A. Kaboré, S. Sanou, A-s, Ouedraogo); Centre-Muraz, Bobo-Dioulasso (E. Kabré, S. Ouangraoua)

Main Article

Table 1

Sequences and concentrations of primers and probes used to detect Streptococcus suis, S. agalactiae, and S. pyogenes, Burkina Faso*

Target gene Forward primer, 5¢ ® 3¢ Reverse primer, 5¢ ® 3¢ Probe, 5¢ ® 3¢ Concentration of oligo per reaction, nM†
cfb (7), GBS GGGAACAGATTATGAAAAACCG AAGGCTTCTACACGACTACCAA AGACTTCATTGCGTGCCAACCCTGAGAC
5¢-HEX; 3¢-BHQ1 200/200/200
fbpS (8), S. suis TCCRATRCTGCTCTGCCATT TGATAGTAGAAGTCCAGCARACT AATAGCCC”T”GAAAAMCAGCCACWYTTTGARA
5¢-FAM; 3¢-SpC6; “T” = BHQ1 200/200/100
spy (9), GAS GCACTCGCTACTATTTCTTACCTCAA GTCACAATGTCTTGGAAACCAGTAAT CCGCAAC”T”CATCAAGGATTTCGTTACCA
5¢-Cy-5; 3¢- SpC6; “T” = BHQ2 300/300/100
RNaseP (10) AGATTTGGACCTGCGAGCG GAGCGGCTGTCCCACAAGT TTCTGACCTGAAGGCTCTGCGCG
5¢-FAM; 3¢-BHQ1 400/400/100

*GAS, group A Streptococcus (Streptococcus pyogenes); GBS, group A Streptococcus (S. agalactiae); RNaseP, human ribonuclease P.
†Concentration of forward primer/reverse primer/probe.

Main Article

References
  1. Goyette-Desjardins  G, Auger  JP, Xu  J, Segura  M, Gottschalk  M. Streptococcus suis, an important pig pathogen and emerging zoonotic agent-an update on the worldwide distribution based on serotyping and sequence typing. Emerg Microbes Infect. 2014;3:e45. DOIPubMedGoogle Scholar
  2. Dutkiewicz  J, Sroka  J, Zając  V, Wasiński  B, Cisak  E, Sawczyn  A, et al. Streptococcus suis: a re-emerging pathogen associated with occupational exposure to pigs or pork products. Part I - Epidemiology. Ann Agric Environ Med. 2017;24:683–95. DOIPubMedGoogle Scholar
  3. Gottschalk  M, Xu  J, Calzas  C, Segura  M. Streptococcus suis: a new emerging or an old neglected zoonotic pathogen? Future Microbiol. 2010;5:371–91. DOIPubMedGoogle Scholar
  4. Strangmann  E, Fröleke  H, Kohse  KP. Septic shock caused by Streptococcus suis: case report and investigation of a risk group. Int J Hyg Environ Health. 2002;205:385–92. DOIPubMedGoogle Scholar
  5. Mai  NTH, Hoa  NT, Nga  TVT, Linh  D, Chau  TTH, Sinh  DX, et al. Streptococcus suis meningitis in adults in Vietnam. Clin Infect Dis. 2008;46:659–67. DOIPubMedGoogle Scholar
  6. Kambiré  D, Soeters  HM, Ouédraogo-Traoré  R, Medah  I, Sangare  L, Yaméogo  I, et al.; MenAfriNet Consortium. MenAfriNet Consortium. Nationwide trends in bacterial meningitis before the introduction of 13-valent pneumococcal conjugate vaccine–Burkina Faso, 2011–2013. PLoS One. 2016;11:e0166384. DOIPubMedGoogle Scholar
  7. Diaz  MH, Waller  JL, Napoliello  RA, Islam  MS, Wolff  BJ, Burken  DJ, et al. Optimization of multiple pathogen detection using the TaqMan array card: application for a population-based study of neonatal infection. PLoS One. 2013;8:e66183. DOIPubMedGoogle Scholar
  8. Srinivasan  V, McGee  L, Njanpop-Lafourcade  BM, Moïsi  J, Beall  B. Species-specific real-time PCR assay for the detection of Streptococcus suis from clinical specimens. Diagn Microbiol Infect Dis. 2016;85:131–2. DOIPubMedGoogle Scholar
  9. Kodani  M, Yang  G, Conklin  LM, Travis  TC, Whitney  CG, Anderson  LJ, et al. Application of TaqMan low-density arrays for simultaneous detection of multiple respiratory pathogens. J Clin Microbiol. 2011;49:2175–82. DOIPubMedGoogle Scholar
  10. Emery  SL, Erdman  DD, Bowen  MD, Newton  BR, Winchell  JM, Meyer  RF, et al. Real-time reverse transcription-polymerase chain reaction assay for SARS-associated coronavirus. Emerg Infect Dis. 2004;10:311–6. DOIPubMedGoogle Scholar
  11. Ouattara  M, Whaley  MJ, Jenkins  LT, Schwartz  SB, Traore  RO, Diarra  S, et al. Triplex real-time PCR assay for the detection of Streptococcus pneumoniae, Neisseria meningitidis and Haemophilus influenzae directly from clinical specimens without extraction of DNA. Diagn Microbiol Infect Dis. 2018.
  12. Kerdsin  A, Akeda  Y, Hatrongjit  R, Detchawna  U, Sekizaki  T, Hamada  S, et al. Streptococcus suis serotyping by a new multiplex PCR. J Med Microbiol. 2014;63:824–30. DOIPubMedGoogle Scholar
  13. Tall  H, Njanpop-Lafourcade  BM, Mounkoro  D, Tidjani  L, Agbenoko  K, Alassani  I, et al. Identification of Streptococcus suis meningitis through population-based surveillance, Togo, 2010–2014. Emerg Infect Dis. 2016;22:1262–4. DOIPubMedGoogle Scholar
  14. Prince-David  M, Salou  M, Marois-Créhan  C, Assogba  K, Plainvert  C, Balogou  KA, et al. Human meningitis due to Streptococcus suis in Lomé, Togo: a case report. BMC Infect Dis. 2016;16:651. DOIPubMedGoogle Scholar
  15. Raberahona  M, Rasoanandrasana  S, Rahajamanana  VL, Ranaivo-Rabetokotany  F, Andriananja  V, Rakotomalala  FA, et al. Novel Streptococcus suis sequence type 834 among humans, Madagascar. Emerg Infect Dis. 2018;24:391–2. DOIPubMedGoogle Scholar

Main Article

URL Validation failed because the page https://doi.org/10.3201/eid2609.200203 does not exist (HTTP error 404).

CrossRef reports the first page should be "1", not "e45". (Ref. 1 "Goyette-Desjardins, Auger, Xu, Segura, Gottschalk, 2014")

eXtyles has not updated the authors because of a name mismatch. Please compare "Mai" with "Thi Hoang Mai", "Hoa" with "Thi Hoa", "Nga" with "Vu Thieu Nga", "Linh" with "Dieu Linh", "Chau" with "Thi Hong Chau", and "Sinh" with "Xuan Sinh". The CrossRef authors are Thi Hoang Mai N, Thi Hoa N, Vu Thieu Nga T, Dieu Linh L, Thi Hong Chau T, Xuan Sinh D, et al.. (Ref. 5 "Mai, Hoa, Nga, Linh, Chau, Sinh, et al., 2008")

eXtyles has not updated the article title because Medline's is slightly different and Title Case. The Medline article title is Nationwide Trends in Bacterial Meningitis before the Introduction of 13-Valent Pneumococcal Conjugate Vaccine-Burkina Faso, 2011-2013.. (Ref. 6 "Kambiré, Soeters, Ouédraogo-Traoré, Medah, Sangare, Yaméogo, et al., 2016")

Page created: July 06, 2020
Page updated: August 19, 2020
Page reviewed: August 19, 2020
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external