Volume 27, Number 8—August 2021
Research
Spotted Fever Group Rickettsioses in Israel, 2010–2019
Table 1
Oligonucleotide primers used for PCR amplification and sequencing of Rickettsia species in study of spotted fever group rickettsioses in Israel, 2010–2019*
Primer | Target gene | Primer sequence, 5′ → 3′ |
---|---|---|
213F | OmpA | AATCAATATTGGAGCCGGTAA |
667R | OmpA | ATTTGCATCAATCGTATAAGTAGC |
120F | OmpA | AAGGAGCTATAGCAAACGGCA |
760R | OmpA | TATCAGGGTCTATATTCGCACCTA |
760newF | OmpA | TAGGTGCGAATATAGACCCTGATA |
1231R | OmpA | TGGCAATAGTTACATTTCCTGCAC |
373F | gltA | TTGTAGCTCTTCTCATCCTATGGC |
1138R | gltA | CATTTGCGACGGTATACCCATA |
Rico173F | gltA | CGACCCGGGTTTTATGTCTA |
1179R | gltA | TCCAGCCTACGATTCTTGCTA |
gltA_EXT_R | gltA | TACTCTCTATGTACATAACCGGTG |
gltA_NES_F | gltA | ATGATTGCTAAGATACCTACCATC |
1497_R | OmpB | CCTATATCGCCGGTAATT |
3462_F | OmpB | CCACAGGAACTACAACCATT |
4346_R | OmpB | CGAAGAAGTAACGCTGACTT |
607_F | OmpB | AATATCGGTGACGGTCAAGG |
D1390R | Sca4 | CTTGCTTTTCAGCAATATCAC |
D767F | Sca4 | CGATGGTAGCATTAAAAGCT |
References
- Diop A, Raoult D, Fournier PE. Rickettsial genomics and the paradigm of genome reduction associated with increased virulence. Microbes Infect. 2018;20:401–9. DOIPubMedGoogle Scholar
- Blanton LS, Walker DH. Rickettsia rickettsii and other spotted fever group rickettsiae (Rocky Mountain spotted fever and other spotted fevers). In: Bennett JE, Dolin R, Blaser MJ, editors. Mandell, Douglas, and Bennett’s principles and practice of infectious diseases, 9th ed. Amsterdam: Elsevier; 2020.
- Parola P, Paddock CD, Socolovschi C, Labruna MB, Mediannikov O, Kernif T, et al. Update on tick-borne rickettsioses around the world: a geographic approach. Clin Microbiol Rev. 2013;26:657–702. DOIPubMedGoogle Scholar
- Bacellar F, Beati L, França A, Poças J, Regnery R, Filipe A. Israeli spotted fever rickettsia (Rickettsia conorii complex) associated with human disease in Portugal. Emerg Infect Dis. 1999;5:835–6. DOIPubMedGoogle Scholar
- Colomba C, Trizzino M, Giammanco A, Bonura C, Di Bona D, Tolomeo M, et al. Israeli Spotted Fever in Sicily. Description of two cases and minireview. Int J Infect Dis. 2017;61:7–12. DOIPubMedGoogle Scholar
- Zhu Y, Fournier PE, Eremeeva M, Raoult D. Proposal to create subspecies of Rickettsia conorii based on multi-locus sequence typing and an emended description of Rickettsia conorii. BMC Microbiol. 2005;5:11. DOIPubMedGoogle Scholar
- Znazen A, Hammami B, Lahiani D, Ben Jemaa M, Hammami A. Israeli spotted fever, Tunisia. Emerg Infect Dis. 2011;17:1328–30. DOIPubMedGoogle Scholar
- Angelakis E, Richet H, Raoult D. Rickettsia sibirica mongolitimonae Infection, France, 2010-2014. Emerg Infect Dis. 2016;22:880–2. DOIPubMedGoogle Scholar
- Cohen R, Babushkin F, Shapiro M, Uda M, Atiya-Nasagi Y, Klein D, et al. Two cases of Israeli spotted fever with purpura fulminans, Sharon District, Israel. Emerg Infect Dis. 2018;24:835–40. DOIPubMedGoogle Scholar
- de Sousa R, Nóbrega SD, Bacellar F, Torgal J. Mediterranean spotted fever in Portugal: risk factors for fatal outcome in 105 hospitalized patients. Ann N Y Acad Sci. 2003;990:285–94. DOIPubMedGoogle Scholar
- Parola P, Rovery C, Rolain JM, Brouqui P, Davoust B, Raoult D. Rickettsia slovaca and R. raoultii in tick-borne Rickettsioses. Emerg Infect Dis. 2009;15:1105–8. DOIPubMedGoogle Scholar
- Sousa R, França A, Dória Nòbrega S, Belo A, Amaro M, Abreu T, et al. Host- and microbe-related risk factors for and pathophysiology of fatal Rickettsia conorii infection in Portuguese patients. J Infect Dis. 2008;198:576–85. DOIPubMedGoogle Scholar
- Raoult D, Weiller PJ, Chagnon A, Chaudet H, Gallais H, Casanova P. Mediterranean spotted fever: clinical, laboratory and epidemiological features of 199 cases. Am J Trop Med Hyg. 1986;35:845–50. DOIPubMedGoogle Scholar
- Aharonowitz G, Koton S, Segal S, Anis E, Green MS. Epidemiological characteristics of spotted fever in Israel over 26 years. Clin Infect Dis. 1999;29:1321–2. DOIPubMedGoogle Scholar
- Weinberger M, Keysary A, Sandbank J, Zaidenstein R, Itzhaki A, Strenger C, et al. Fatal Rickettsia conorii subsp. israelensis infection, Israel. Emerg Infect Dis. 2008;14:821–4. DOIPubMedGoogle Scholar
- Paddock CD, Childs JE, Zaki SR, Berger SA. Reply. J Infect Dis. 2000;181:810–2. DOIPubMedGoogle Scholar
- Leitner M, Yitzhaki S, Rzotkiewicz S, Keysary A. Polymerase chain reaction-based diagnosis of Mediterranean spotted fever in serum and tissue samples. Am J Trop Med Hyg. 2002;67:166–9. DOIPubMedGoogle Scholar
- Regev-Yochay G, Segal E, Rubinstein E. Glucose-6-phosphate dehydrogenase deficiency: possible determinant for a fulminant course of Israeli spotted fever. Isr Med Assoc J. 2000;2:781–2.PubMedGoogle Scholar
- Ergas D, Sthoeger ZM, Keysary A, Strenger C, Leitner M, Zimhony O. Early diagnosis of severe Mediterranean spotted fever cases by nested-PCR detecting spotted fever Rickettsiae 17-kD common antigen gene. Scand J Infect Dis. 2008;40:965–7. DOIPubMedGoogle Scholar
- Cohen J, Lasri Y, Landau Z; Joel Cohen, Yechiel Lasri, Zvi Land. Mediterranean spotted fever in pregnancy. Scand J Infect Dis. 1999;31:202–3. DOIPubMedGoogle Scholar
- Bentov Y, Sheiner E, Kenigsberg S, Mazor M. Mediterranean spotted fever during pregnancy: case presentation and literature review. Eur J Obstet Gynecol Reprod Biol. 2003;107:214–6. DOIPubMedGoogle Scholar
- Shazberg G, Moise J, Terespolsky N, Hurvitz H. Family outbreak of Rickettsia conorii infection. Emerg Infect Dis. 1999;5:723–4. DOIPubMedGoogle Scholar
- Cwikel BJ, Ighbarieh J, Sarov I. Antigenic polypeptides of Israeli spotted fever isolates compared with other spotted fever group rickettsiae. Ann N Y Acad Sci. 1990;590(1 Rickettsiolog):381–8.
- Israel Center for Disease Control Ministry of Health. Publication files, infectious diseases, notifiable infectious diseases in Israel [in Hebrew] [cited 2020 Apr 15]. https://www.health.gov.il/UnitsOffice/HD/PH/epidemiology/Pages/epidemiology_report.aspx
- Harrus S, Perlman-Avrahami A, Mumcuoglu KY, Morick D, Baneth G. Molecular detection of Rickettsia massiliae, Rickettsia sibirica mongolitimonae and Rickettsia conorii israelensis in ticks from Israel. Clin Microbiol Infect. 2011;17:176–80. DOIPubMedGoogle Scholar
- Keysary A, Strenger C. Use of enzyme-linked immunosorbent assay techniques with cross-reacting human sera in diagnosis of murine typhus and spotted fever. J Clin Microbiol. 1997;35:1034–5. DOIPubMedGoogle Scholar
- Klein D, Beth-Din A, Cohen R, Lazar S, Glinert I, Zayyad H, et al. New spotted fever group Rickettsia isolate, identified by sequence analysis of conserved genomic regions. Pathogens. 2019;9:
E11 . DOIPubMedGoogle Scholar - Roux V, Raoult D. Phylogenetic analysis of members of the genus Rickettsia using the gene encoding the outer-membrane protein rOmpB (ompB). Int J Syst Evol Microbiol. 2000;50:1449–55. DOIPubMedGoogle Scholar
- Sekeyova Z, Roux V, Raoult D. Phylogeny of Rickettsia spp. inferred by comparing sequences of ‘gene D’, which encodes an intracytoplasmic protein. Int J Syst Evol Microbiol. 2001;51:1353–60. DOIPubMedGoogle Scholar
- Bechah Y, Socolovschi C, Raoult D. Identification of rickettsial infections by using cutaneous swab specimens and PCR. Emerg Infect Dis. 2011;17:83–6. DOIPubMedGoogle Scholar
- Rose J, Nachum-Biala Y, Mumcuoglu KY, Alkhamis MA, Ben-Nun A, Lensky I, et al. Genetic characterization of spotted fever group rickettsiae in questing ixodid ticks collected in Israel and environmental risk factors for their infection. Parasitology. 2017;144:1088–101. DOIPubMedGoogle Scholar
- Sentausa E, El Karkouri K, Robert C, Raoult D, Fournier PE. Genome sequence of Rickettsia conorii subsp. israelensis, the agent of Israeli spotted fever. J Bacteriol. 2012;194:5130–1. DOIPubMedGoogle Scholar
- Heitman KN, Drexler NA, Cherry-Brown D, Peterson AE, Armstrong PA, Kersh GJ. National surveillance data show increase in spotted fever rickettsiosis: United States, 2016-2017. Am J Public Health. 2019;109:719–21. DOIPubMedGoogle Scholar
- Mumcuoglu KY, Keysary A, Gilead L. Mediterranean spotted fever in Israel: a tick-borne disease. Isr Med Assoc J. 2002;4:44–9.PubMedGoogle Scholar
- Ereqat S, Nasereddin A, Al-Jawabreh A, Azmi K, Harrus S, Mumcuoglu K, et al. Molecular detection and identification of spotted fever group rickettsiae in ticks collected from the West Bank, Palestinian Territories. PLoS Negl Trop Dis. 2016;10:
e0004348 . DOIPubMedGoogle Scholar - Kamani J, Baneth G, Mumcuoglu KY, Waziri NE, Eyal O, Guthmann Y, et al. Molecular detection and characterization of tick-borne pathogens in dogs and ticks from Nigeria. PLoS Negl Trop Dis. 2013;7:
e2108 . DOIPubMedGoogle Scholar - Chisu V, Masala G, Foxi C, Socolovschi C, Raoult D, Parola P. Rickettsia conorii israelensis in Rhipicephalus sanguineus ticks, Sardinia, Italy. Ticks Tick Borne Dis. 2014;5:446–8. DOIPubMedGoogle Scholar
- Waner T, Keysary A, Eremeeva ME, Din AB, Mumcuoglu KY, King R, et al. Rickettsia africae and Candidatus Rickettsia barbariae in ticks in Israel. Am J Trop Med Hyg. 2014;90:920–2. DOIPubMedGoogle Scholar
- Eldin C, Virgili G, Attard L, Edouard S, Viale P, Raoult D, et al. Rickettsia massiliae infection after a tick bite on the eyelid. Travel Med Infect Dis. 2018;26:66–8. DOIPubMedGoogle Scholar
- Socolovschi C, Gaudart J, Bitam I, Huynh TP, Raoult D, Parola P. Why are there so few Rickettsia conorii conorii-infected Rhipicephalus sanguineus ticks in the wild? PLoS Negl Trop Dis. 2012;6:
e1697 . DOIPubMedGoogle Scholar - Parola P, Socolovschi C, Raoult D. Deciphering the relationships between Rickettsia conorii conorii and Rhipicephalus sanguineus in the ecology and epidemiology of Mediterranean spotted fever. Ann N Y Acad Sci. 2009;1166:49–54. DOIPubMedGoogle Scholar
- Socolovschi C, Raoult D, Parola P. Influence of temperature on the attachment of Rhipicephalus sanguineus ticks on rabbits. Clin Microbiol Infect. 2009;15(Suppl 2):326–7. DOIPubMedGoogle Scholar
Page created: June 09, 2021
Page updated: July 18, 2021
Page reviewed: July 18, 2021
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.