Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link

Volume 28, Number 4—April 2022

Research

Molecular Surveillance for Imported Antimicrobial Resistant Plasmodium falciparum, Ontario, Canada

Ruwandi Kariyawasam, Rachel Lau, Eric Shao, Katherine Tan, Adrienne Showler, Filip Ralevski, Samir N. Patel, and Andrea K. BoggildComments to Author 
Author affiliations: University of Alberta, Edmonton, Alberta, Canada (R. Kariyawasam); Alberta Precision Labs-Public Health, Edmonton (R. Kariyawasam); Public Health Ontario Laboratory, Toronto, Ontario, Canada (R. Lau, F. Ralevski, S.N. Patel); University of Western Ontario, London, Ontario (E. Shao); University of Toronto, Toronto (K. Tan, A. Showler, S.N. Patel, A.K. Boggild); Georgetown University, Washington, DC, USA (A. Showler); Toronto General Hospital, Toronto (A. Showler, A.K. Boggild)

Main Article

Table 1

Primer sets used for pyrosequencing and Sanger sequencing for Plasmodium falciparum resistance testing*

Primer† Sequence, 5′ → 3′
Pf ATPase 6 codon 623
Forward primer CACCAAGGGGTATCAACAAATTC
Biotinylated reverse primer (HPLC purified) CTTGTGCCATGCTCAAATGTATT
Sequence primer
TCTAATTATACTACAGCTCA
Pf ATPase 6 codon 769
Biotinylated forward primer (HPLC purified) CAAAATATGGGAAAAAGAGCATTA
Reverse primer TCTGGCCGTATTAATATTATCACC
Sequence primer
ATAAATTAAATCTTGTTCTA
Pf cytb
Forward primer CGTCCTGATAATGCTATCGTAGTAAATAC
Biotinylated reverse primer (HPLC purified) CAGGCATCTAACATGGATATAGCA
Sequence primer
TGGTACTTTCTACCATT
pfcrt
Biotinylated forward primer (HPLC purified) GGAGGTTCTTGTCTTGGTAAA
Reverse primer CAGGCATCTAACATGGATATAGCA
Sequence primer
TTTGTTTAAAGTTCTTTTAG
Pf MDR1 codon 86
Forward primer CGTTTAAATGTTTACCTGCACAA
Biotinylated reverse primer (HPLC purified) TTGTCCATCTTGATAAAAAACACT
Sequence primer
GTGTAATATTAAAGAACATG
Pf MDR1 codon 184
Forward primer AGTTCAGGAATTGGTACGAAATTT
Biotinylated reverse primer (HPLC purified) AACGTGCATTTTTTATTAATGACC
Sequence primer
CCAGTTCCTTTTTAGGTT
Pf MDR1 codon 1034, 1042
Forward primer GCGGAGTTTTTGCATTTAGTTCA
Biotinylated reverse primer (HPLC purified) TTAAGAAGGATCCAAACCAATAGG
Sequence primer
GCAGCTTTATGGGGAT
Pf MDR1 codon 1246
Biotinylated forward primer (HPLC purified) TTTTCAAACCAATCTGGATCTG
Reverse primer CGTTTAACATCTTCCAATGTTGC
Sequence primer
ATTGAAAATAAGTTTCTAAG
Pf dhfr codon 16
Biotinylated forward primer AACAAGTCTGCGACGTTTTCGATA
Reverse primer CCCCTCATTTTTGCTTTCAACC
Sequence primer
GCTTTCAACCTTACAACA
Pf dhfr codon 51, 51, 59
Forward primer TGAGGGGAAAAAAAATGAGGTT
Biotinylated reverse primer (HPLC purified) AAGGTTTAAATTTTTTTGGAATGC
Sequence primer
AAAGGAGTATTACCATGGA
Pf dhfr codon 108
Biotinylated forward primer CAAAATGTTGTAGTTATGGGAAGA
Reverse primer TTTAAATTTTTTTGGAATGCTTTC
Sequence primer
TGGAATGCTTTCCCAG
Pf dhfr codon 164
Biotinylated forward primer (HPLC purified) GTTTTACTTGGGAAATTAAATTACT
Reverse primer TCTGGAAAAAATACATCACATTC
Sequence primer
ACAACGGAACCTCCTA
Pf dhps codon 436, 437
Forward primer ACGTGCTGTTCAAAGAATGTTT
Biotinylated reverse primer (HPLC purified) GTTTCGCATCACATTTAACAATT
Sequence primer
ATAGATATAGGTGGAGAATC
Pf dhps Codon 540
Biotinylated forward primer (HPLC purified) GCATAAAAGAGGAAATCCACATAC
Reverse primer CGAGGTATTCCATTTAATACAAGA
Sequence primer
ATTATCATAATTTGTTAGTT
Pf dhps codon 581
Forward primer ACCTCGTTATAGGATACTATTTGA
Biotinylated reverse primer (HPLC purified) TCCAATAAAAAGTGGATACTCATC
Sequence primer
TTGATATTGGATTAGGATTT
Pf dhps codon 613
Biotinylated forward primer (HPLC purified) TCCACTTTTTATTGGATATTCAAG
Reverse primer CTGAAACATCCAATTGTGTGAT
Sequence primer
CATTCATGCAATGGG
kelch13
K13_PCR_F CGGAGTGACCAAATCTGGA
K13_PCR_R GGGAATCTGGTGGTAACAGC
K13_N1_F GCAAGCTGCCATTCATTTG
K13_N1_R GCCTTGTTGAAAGAAGCAGA
K13_N2_F CGCCAGCATTGTTGACTAAT
K13_N2_R GCGGAGTAGTAGCGAGAAT

*Pyrosequencing using Pyromark PCR Kit protocol (QIAGEN, https://www.qiagen.com). cytb, cytochrome b; dhfr, dihydrofolate reductase; dhps, dihydropteroate synthetase; HPLC, high performance liquid chromatography; MDR, multidrug resistance; Pf, P. falciparum; pfcrt, P. falciparum chloroquine resistance transporter †See (10).

Main Article

References
  1. Phuong  M, Lau  R, Ralevski  F, Boggild  AK. Sequence-based optimization of a quantitative real-time PCR assay for detection of Plasmodium ovale and Plasmodium malariae. J Clin Microbiol. 2014;52:1068–73. DOIPubMedGoogle Scholar
  2. World Health Organization. Fact Sheet: World Malaria Report 2020 [cited 2022 Feb 27]. https://www.who.int/publications/i/item/9789240015791
  3. Gregson  A, Plowe  CV. Mechanisms of resistance of malaria parasites to antifolates. Pharmacol Rev. 2005;57:117–45. DOIPubMedGoogle Scholar
  4. Paul  REL, Diallo  M, Brey  PT. Mosquitoes and transmission of malaria parasites - not just vectors. Malar J. 2004;3:39. DOIPubMedGoogle Scholar
  5. McCarthy  AE, Morgan  C, Prematunge  C, Geduld  J. Severe malaria in Canada, 2001-2013. Malar J. 2015;14:151. DOIPubMedGoogle Scholar
  6. Phuong  M, Lau  R, Ralevski  F, Boggild  AK. Survival analysis of diagnostic assays in Plasmodium falciparum malaria. Malar J. 2015;14:350. DOIPubMedGoogle Scholar
  7. Shokoples  SE, Ndao  M, Kowalewska-Grochowska  K, Yanow  SK. Multiplexed real-time PCR assay for discrimination of Plasmodium species with improved sensitivity for mixed infections. J Clin Microbiol. 2009;47:975–80. DOIPubMedGoogle Scholar
  8. Menard  D, Ariey  F. PCR and sequencing for genotyping of candidate Plasmodium falciparum artemisinin resistance SNPs in the Kelch 13 gene. Paris: Institut Pasteur du Cambodge; 2013.
  9. Ariey  F, Witkowski  B, Amaratunga  C, Beghain  J, Langlois  AC, Khim  N, et al. A molecular marker of artemisinin-resistant Plasmodium falciparum malaria. Nature. 2014;505:50–5. DOIPubMedGoogle Scholar
  10. Koressaar  T, Remm  M. Enhancements and modifications of primer design program Primer3. Bioinformatics. 2007;23:1289–91. DOIPubMedGoogle Scholar
  11. Untergasser  A, Cutcutache  I, Koressaar  T, Ye  J, Faircloth  BC, Remm  M, et al. Primer3—new capabilities and interfaces. Nucleic Acids Res. 2012;40:e115. DOIPubMedGoogle Scholar
  12. Price  RN, Uhlemann  AC, Brockman  A, McGready  R, Ashley  E, Phaipun  L, et al. Mefloquine resistance in Plasmodium falciparum and increased pfmdr1 gene copy number. Lancet. 2004;364:438–47. DOIPubMedGoogle Scholar
  13. Livak  KJ, Schmittgen  TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Δ Δ C(T)) Method. Methods. 2001;25:402–8. DOIPubMedGoogle Scholar
  14. Lulitanond  V, Intapan  PM, Tantrawatpan  C, Sankuntaw  N, Sanpool  O, Janwan  P, et al. Molecular markers for detection and differentiation of Plasmodium falciparum and Plasmodium vivax in human blood samples by pyrosequencing. J Clin Microbiol. 2012;50:1455–7. DOIPubMedGoogle Scholar
  15. Dondorp  AM, Yeung  S, White  L, Nguon  C, Day  NPJ, Socheat  D, et al. Artemisinin resistance: current status and scenarios for containment. Nat Rev Microbiol. 2010;8:272–80. DOIPubMedGoogle Scholar
  16. Djimdé  A, Doumbo  OK, Cortese  JF, Kayentao  K, Doumbo  S, Diourté  Y, et al. A molecular marker for chloroquine-resistant falciparum malaria. N Engl J Med. 2001;344:257–63. DOIPubMedGoogle Scholar
  17. Olukosi  YA, Oyebola  MK, Ajibaye  O, Orok  BA, Aina  OO, Agomo  CO, et al. Persistence of markers of chloroquine resistance among P. falciparum isolates recovered from two Nigerian communities. MWJ. 2014;5:3.
  18. Mekonnen  SK, Aseffa  A, Berhe  N, Teklehaymanot  T, Clouse  RM, Gebru  T, et al. Return of chloroquine-sensitive Plasmodium falciparum parasites and emergence of chloroquine-resistant Plasmodium vivax in Ethiopia. Malar J. 2014;13:244. DOIPubMedGoogle Scholar
  19. Price  RN, Cassar  C, Brockman  A, Duraisingh  M, van Vugt  M, White  NJ, et al. The pfmdr1 gene is associated with a multidrug-resistant phenotype in Plasmodium falciparum from the western border of Thailand. Antimicrob Agents Chemother. 1999;43:2943–9. DOIPubMedGoogle Scholar
  20. Ngo  T, Duraisingh  M, Reed  M, Hipgrave  D, Biggs  B, Cowman  AF. Analysis of pfcrt, pfmdr1, dhfr, and dhps mutations and drug sensitivities in Plasmodium falciparum isolates from patients in Vietnam before and after treatment with artemisinin. Am J Trop Med Hyg. 2003;68:350–6. DOIPubMedGoogle Scholar
  21. Zalis  MG, Pang  L, Silveira  MS, Milhous  WK, Wirth  DF. Characterization of Plasmodium falciparum isolated from the Amazon region of Brazil: evidence for quinine resistance. Am J Trop Med Hyg. 1998;58:630–7. DOIPubMedGoogle Scholar
  22. Triglia  T, Cowman  AF. Primary structure and expression of the dihydropteroate synthetase gene of Plasmodium falciparum. Proc Natl Acad Sci U S A. 1994;91:7149–53. DOIPubMedGoogle Scholar
  23. Brooks  DR, Wang  P, Read  M, Watkins  WM, Sims  PF, Hyde  JE. Sequence variation of the hydroxymethyldihydropterin pyrophosphokinase: dihydropteroate synthase gene in lines of the human malaria parasite, Plasmodium falciparum, with differing resistance to sulfadoxine. Eur J Biochem. 1994;224:397–405. DOIPubMedGoogle Scholar
  24. Mharakurwa  S, Kumwenda  T, Mkulama  MA, Musapa  M, Chishimba  S, Shiff  CJ, et al. Malaria antifolate resistance with contrasting Plasmodium falciparum dihydrofolate reductase (DHFR) polymorphisms in humans and Anopheles mosquitoes. Proc Natl Acad Sci U S A. 2011;108:18796–801. DOIPubMedGoogle Scholar
  25. Peterson  DS, Walliker  D, Wellems  TE. Evidence that a point mutation in dihydrofolate reductase-thymidylate synthase confers resistance to pyrimethamine in falciparum malaria. Proc Natl Acad Sci U S A. 1988;85:9114–8. DOIPubMedGoogle Scholar
  26. Foote  SJ, Galatis  D, Cowman  AF. Amino acids in the dihydrofolate reductase-thymidylate synthase gene of Plasmodium falciparum involved in cycloguanil resistance differ from those involved in pyrimethamine resistance. Proc Natl Acad Sci U S A. 1990;87:3014–7. DOIPubMedGoogle Scholar
  27. Jambou  R, Legrand  E, Niang  M, Khim  N, Lim  P, Volney  B, et al. Resistance of Plasmodium falciparum field isolates to in-vitro artemether and point mutations of the SERCA-type PfATPase6. Lancet. 2005;366:1960–3. DOIPubMedGoogle Scholar
  28. Ashley  EA, Dhorda  M, Fairhurst  RM, Amaratunga  C, Lim  P, Suon  S, et al.; Tracking Resistance to Artemisinin Collaboration (TRAC). Spread of artemisinin resistance in Plasmodium falciparum malaria. N Engl J Med. 2014;371:411–23. DOIPubMedGoogle Scholar
  29. Torrentino-Madamet  M, Fall  B, Benoit  N, Camara  C, Amalvict  R, Fall  M, et al. Limited polymorphisms in k13 gene in Plasmodium falciparum isolates from Dakar, Senegal in 2012-2013. Malar J. 2014;13:472. DOIPubMedGoogle Scholar
  30. Sutherland  CJ, Lansdell  P, Sanders  M, Muwanguzi  J, van Schalkwyk  DA, Kaur  H, et al. Pfk13-independent treatment failure in four imported cases of Plasmodium falciparum malaria treated with artemether-lumefantrine in the United Kingdom. Antimicrob Agents Chemother. 2017;61:e02382–16. DOIPubMedGoogle Scholar
  31. Mohon  AN, Alam  MS, Bayih  AG, Folefoc  A, Shahinas  D, Haque  R, et al. Mutations in Plasmodium falciparum K13 propeller gene from Bangladesh (2009-2013). Malar J. 2014;13:431. DOIPubMedGoogle Scholar
  32. Tun  KM, Imwong  M, Lwin  KM, Win  AA, Hlaing  TM, Hlaing  T, et al. Spread of artemisinin-resistant Plasmodium falciparum in Myanmar: a cross-sectional survey of the K13 molecular marker. Lancet Infect Dis. 2015;15:415–21. DOIPubMedGoogle Scholar
  33. Cooper  RA, Conrad  MD, Watson  QD, Huezo  SJ, Ninsiima  H, Tumwebaze  P, et al. Lack of artemisinin resistance in Plasmodium falciparum in Uganda based on parasitological and molecular assays. Antimicrob Agents Chemother. 2015;59:5061–4. DOIPubMedGoogle Scholar
  34. Ménard  D, Khim  N, Beghain  J, Adegnika  AA, Shafiul-Alam  M, Amodu  O, et al.; KARMA Consortium. KARMA Consortium. KARMA Consortium. A worldwide map of Plasmodium falciparum k13-propeller polymorphisms. N Engl J Med. 2016;374:2453–64. DOIPubMedGoogle Scholar
  35. Daily  JP. k13-propeller mutations and malaria resistance. N Engl J Med. 2016;374:2492–3. DOIPubMedGoogle Scholar
  36. Schwartz  E, Bujanover  S, Kain  KC. Genetic confirmation of atovaquone-proguanil-resistant Plasmodium falciparum malaria acquired by a nonimmune traveler to East Africa. Clin Infect Dis. 2003;37:450–1. DOIPubMedGoogle Scholar
  37. Musset  L, Bouchaud  O, Matheron  S, Massias  L, Le Bras  J. Clinical atovaquone-proguanil resistance of Plasmodium falciparum associated with cytochrome b codon 268 mutations. Microbes Infect. 2006;8:2599–604. DOIPubMedGoogle Scholar
  38. David  KP, Alifrangis  M, Salanti  A, Vestergaard  LS, Rønn  A, Bygbjerg  IB. Atovaquone/proguanil resistance in Africa: a case report. Scand J Infect Dis. 2003;35:897–8. DOIPubMedGoogle Scholar
  39. Pimentel  S, Nogueira  F, Benchimol  C, Quinhentos  V, Bom  J, Varandas  L, et al. Detection of atovaquone-proguanil resistance conferring mutations in Plasmodium falciparum cytochrome b gene in Luanda, Angola. Malar J. 2006;5:30. DOIPubMedGoogle Scholar
  40. Savini  H, Bogreau  H, Bertaux  L, Bouchiba  H, Kraemer  P, Parzy  D, et al. First case of emergence of atovaquone-proguanil resistance in Plasmodium falciparum during treatment in a traveler in Comoros. Antimicrob Agents Chemother. 2008;52:2283–4. DOIPubMedGoogle Scholar
  41. Wichmann  O, Muehlen  M, Gruss  H, Mockenhaupt  FP, Suttorp  N, Jelinek  T. Malarone treatment failure not associated with previously described mutations in the cytochrome b gene. Malar J. 2004;3:14. DOIPubMedGoogle Scholar
  42. Liu  S, Mu  J, Jiang  H, Su  XZ. Effects of Plasmodium falciparum mixed infections on in vitro antimalarial drug tests and genotyping. Am J Trop Med Hyg. 2008;79:178–84. DOIPubMedGoogle Scholar
  43. Sibley  CH, Ringwald  P. A database of antimalarial drug resistance. Malar J. 2006;5:48. DOIPubMedGoogle Scholar

Main Article

Page created: March 08, 2022
Page updated: March 19, 2022
Page reviewed: March 19, 2022
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external