Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link

Volume 29, Number 11—November 2023

Dispatch

Monkeypox Virus in Wastewater Samples from Santiago Metropolitan Region, Chile

Author affiliations: Universidad de Chile, Santiago, Chile (M. Ampuero, R. Soto-Rifo, A. Gaggero); Pontificia Universidad Católica de Chile, Santiago (C. Martínez-Valdebenito, M. Ferrés); Millennium Institute on Immunology and Immunotherapy, Santiago (R. Soto-Rifo)

Cite This Article
Citation for Media

Abstract

Sewage surveillance provides useful epidemiologic and public health information on viral infections at the population level. We detected monkeypox virus DNA from sewage samples covering 85% of the population in Santiago Metropolitan Region Chile. We also isolated infective viruses from those samples. Wastewater surveillance could complement clinical surveillance for monkeypox virus.

On May 13, 2022, the World Health Organization raised an alert caused by a large increase in the number of infections by monkeypox virus (MPXV), which causes mpox, a zoonotic disease endemic to some countries of Central and West Africa that has rapidly expanded to nonendemic countries (1). A case of MPXV infection in Chile was confirmed on July 17, and since then, >1,400 cases and 2 deaths related to mpox have been reported during the outbreak, according to the Chile Ministry of Health (2). The Santiago Metropolitan Region in Chile is the most populated region in the country, accounting for >40% of the total population and most (81%) of the reported MPXV infections (2).

Wastewater surveillance has been demonstrated as a key contributor in monitoring viruses, such as poliovirus and SARS-CoV-2, enabling tracking of new variants and, thus, providing an accurate view of infections at the population level (3–5). In this regard, MPXV detection in sewage samples has also been proposed as a useful complement to clinical surveillance (6–9). Because stigma and discrimination associated with certain infections limit the willingness of at-risk persons to consult hospital centers, wastewater-based epidemiology (WBE) becomes even more useful because anonymous pooled samples enable visualization of the contributions of a community without revealing individual identities (10).

We report wastewater monitoring of MPXV DNA in sewage samples from 3 wastewater treatment plants (WWTPs), accounting for 85% of the overall sewage from Santiago Metropolitan Region, representative of >5.5 million persons. We also report the presence of infective MPXV in those samples.

The Study

We collected 21 raw samples of wastewater during April‒September 2022 from the WWTPs El Trebal (n = 6), La Farfana (n = 6), and La Higuera (n = 9). We collected samples in 1,000-mL sterile propylene flasks, transported them to the Laboratory of Environmental Virology at Universidad de Chile Faculty of Medicine, and stored them at 4°C until processing.

We concentrated the samples by ultracentrifugation according to the protocol described by Fumian et al. (11). We resuspended the pellet obtained in 200 μL of phosphate-buffered saline and stored at −80°C until use.

We used 200 µL of concentrated viral particles to isolate DNA with the QIAamp DNA MiniKit (QIAGEN, https://www.qiagen.com), according to the instructions provided by the supplier. We mixed 5 µL of DNA with the TaqMan Microbe Detection MonkeyPox Vi07922155_s1 (ThermoFisher Scientific, https://www.thermofisher.com) and the TaqPath 1-Step Multiplex Master Mix (ThermoFisher Scientific) for the specific detection of MPXV DNA in a QuantStudio 5 real-time PCR machine (ThermoFisher Scientific). A pMG-Amp plasmid carrying the synthetic MPXV DNA fragment 5′-GTGTCTGAATCGTTCGATTAACCCAACTCATCCATTTTCAGATGAATAGAGTTATCGATTCAGACACATGCTTTGAGTTTTGTTGAATCGATGAGTGAAGTATCATCGGTTGCACCTTCAGATGC-3′, which contains the target sequence of the primers, was synthesized at Macrogen Inc. (https://www.macrogen.com). We used that plasmid as a positive control and as a template for the calibration curve enabling the quantification of MPXV genome copies per milliliter. We cloned the amplified DNA fragment into pGEM-T Easy Vector (Promega, https://www.promega.com) and transformed it into Escherichia coli JM109. Five clones from each sample were sequenced at Macrogen Inc. and compared with MPXV sequences from the 2022 outbreak.

From the 21 sewage samples collected and analyzed from the 3 WWTPs, we detected MPXV DNA in 6 (Table). Consistent with earlier cases of mpox reported in Chile, viral DNA was detected in sewage samples collected in July (La Farfana), August (La Farfana, El Trebal) and September (La Farfana, El Trebal, La Higuera), but not in April or May (Table).

Figure 1

Comparison of nucleotide sequences of the MPXV amplicon obtained for wastewater samples from Santiago Metropolitan Region, Chile (sewage samples 1‒9), with reference sequences obtained from other countries during the 2022 mpox outbreak. The 106-bp amplicon generated by quantitative reverse transcription has 100% homology with MPXV sequences obtained in 2022 from cases reported by different countries. GenBank numbers and location and date of isolation are provided for the 9 Chile sample sequences obtained in this study; GenBank or GISAID (https://www.gisaid.org) accession numbers and country are provided for reference sequences. MPXV, monkeypox virus.

Figure 1. Comparison of nucleotide sequences of the MPXV amplicon obtained for wastewater samples from Santiago Metropolitan Region, Chile (sewage samples 1‒9), with reference sequences obtained from other countries during the 2022...

Quantification of MPXV DNA in sewage showed viral loads ranging from 35 to 2,231 genome copies/mL (Table). Higher viral loads in sewage samples correlated with an increase in the number of cases reported by the Chile Ministry of Health in Santiago. Sequencing of the 106-bp amplified DNA fragment from wastewater samples showed 100% homology with MPXV sequences from the 2022 outbreak reported from Germany, the Netherlands, Italy, France, the United Kingdom, the United States, and Chile (Figure 1).

To determine whether the sewage samples contained viable MPXV, we used the samples that had the highest viral load to inoculate VeroE6 monolayers (ATCC CRL-1586). For this procedure, we infected cells with a mixture of MPXV DNA–positive sewage samples and culture medium and collected the supernatant after 7 days for PCR detection. We stored the remaining supernatant and performed a second round of infection by using the supernatant from the first infection. We used positive and negative controls in separate plates to avoid cross-contamination. At 24- and 48-hours postinfection, we collected supernatant for MPXVDNA detection by PCR.

In addition, we inoculated 300 µL of sample AF0922 supplemented with 700 µL of Dulbecco’s Modified Eagle Medium plus 2% fetal bovine serum (FBS) into VeroE6 cells in a 6-cm plate. After 2 hours of incubation, we replaced the medium with 5 mL of Dulbecco’s Modified Eagle Medium plus 2% FBS. After 7 days, we fixed infected cells with 4% glutaraldehyde and performed negative staining for electron microscopy observation (Appendix Figure) All procedures related to viral isolation were performed in a Biosafety Level 3 laboratory at Unidad de Virología Aplicada, Pontificia Universidad Católica de Chile, Santiago.

Figure 2

Detection of viral genome of monkeypox virus in wastewater samples from wastewater treatment plants in Santiago Metropolitan Region, Chile. A) PCR results for Vero E6 cell supernatant at 7 dpi. B) PCR results for supernatant samples of Vero E6 cells infected with positive control (cell culture supernatant infected with monkeypox virus) and negative controls (Dulbecco’s Modified Eagle Medium plus 2% fetal bovine serum and negative wastewater samples). dpi, days postinfection.

Figure 2. Detection of viral genome of monkeypox virus in wastewater samples from wastewater treatment plants in Santiago Metropolitan Region, Chile. A) PCR results for Vero E6 cell supernatant at 7 dpi....

We detected a high viral DNA load in the supernatant at day 7 postinoculation, suggesting the presence of infective MPXV in sewage samples (Figure 2, panel A). We were not able to detect MPXV DNA from cells inoculated with samples that tested negative for the virus (Figure 2, panel B). Electron microscopy analyses of VeroE6 cells inoculated with MPXV recovered from sample AF0922 showed intracellular viral particles with an average size of ≈300 nm (Appendix Figure).

Conclusions

WBE has acquired an increasingly useful role in surveillance systems that efficiently detect of pathogenic microorganisms. It will also be useful as a tool for control and timely prevention of endemic and emerging infectious diseases.

Using WBE as a complement to universal clinical surveillance enables determination of actual pathogen circulation and its load in a population. For example, WBE has become a useful tool worldwide for visualizing the circulation of SARS-CoV-2 and its variants (3–5). Therefore, WBE could also complement clinical surveillance of MPXV, enabling estimation of actual circulation and load of the virus in a community (6,9). However, it will be useful to generate more information regarding virus elimination in an infected person; viral DNA load in stool, urine, semen, saliva, and other secretions; and persistence and infectivity of the virus in the environment and, in particular, in a matrix as complex as wastewater.

In conclusion, we detected MPXV DNA and determined its concentration in wastewater in Santiago, Chile. We were also able to isolate the virus from samples with the highest viral loads. Although detection of viable virus in sewage samples observed in this study generates an alert, there is no information on the risk that this could have for the personnel working in treatment plants. The potential risk for environmental transmission of MPXV is still unknown and thus remains a serious public health issue.

Mr. Ampuero is a research scientist in the Virology Environmental Laboratory, Universidad de Chile, Santiago, Chile. His primary research interests are identification and characterization of viruses in wastewater.

Top

Acknowledgments

We thank Aguas Andinas, WWTP personnel, Sacyr WWTP personnel, and Analisis Ambientales (https://www.anam.com) operators for providing sewage samples.

This study was supported by the National Agency for Research and Technology through the Fondecyt Program no. 1181656; Anillo grants ATE220007 and ATE220016 to A.G.; Fondecyt Program no. 1230102; Anillo grants ATE220016 and ANID-ICM, ICN2021_045 to R.S.-R.; Anillo grant ATE220061; and Fondecyt Program no. 1211825 to M.F.

A.G. participated in the study design; M.A. and C.M.-V. performed the experiments; A.G., R.S.-R., and M.F. analyzed the data; and A.G., R.S.-R., and C.M.-V. wrote the manuscript. All authors approved the final version of the manuscript.

Top

References

  1. World Health Organization. Mpox (monkeypox) outbreak: global trends, 2022 [cited 2022 Dec 26]. https://worldhealthorg.shinyapps.io/mpx_global
  2. Ministry of Health, Department of Epidemiology, Undersecretary of Public Health. Executive report monkeypox, Chile. December 23, 2022 [in Spanish] [cited 2023 Sep 8]. http://epi.minsal.cl/wp-content/uploads/2022/08/Protocolo_vigilancia_viruela_del_mono_22082022.pdf
  3. Mousazadeh  M, Ashoori  R, Paital  B, Kabdaşlı  I, Frontistis  Z, Hashemi  M, et al. Wastewater based epidemiology perspective as a faster protocol for detecting coronavirus RNA in human populations: a review with specific reference to SARS-CoV-2 virus. Pathogens. 2021;10:1008. DOIPubMedGoogle Scholar
  4. Wu  F, Lee  WL, Chen  H, Gu  X, Chandra  F, Armas  F, et al. Making waves: Wastewater surveillance of SARS-CoV-2 in an endemic future. Water Res. 2022;219:118535. DOIPubMedGoogle Scholar
  5. Karthikeyan  S, Levy  JI, De Hoff  P, Humphrey  G, Birmingham  A, Jepsen  K, et al. Wastewater sequencing reveals early cryptic SARS-CoV-2 variant transmission. Nature. 2022;609:101–8. DOIPubMedGoogle Scholar
  6. Chen  W, Bibby  K. Model-based theoretical evaluation of the feasibility of using wastewater-based epidemiology to monitor monkeypox. Environ Sci Technol Lett. 2022;9:772–8. DOIGoogle Scholar
  7. Gul  I, Liu  C, Yuan  X, Du  Z, Zhai  S, Lei  Z, et al. Current and perspective sensing methods for monkeypox virus. Bioengineering (Basel). 2022;9:571. DOIPubMedGoogle Scholar
  8. de Jonge  EF, Peterse  CM, Koelewijn  JM, van der Drift  AR, van der Beek  RFHJ, Nagelkerke  E, et al. The detection of monkeypox virus DNA in wastewater samples in the Netherlands. Sci Total Environ. 2022;852:158265. DOIPubMedGoogle Scholar
  9. Tiwari  A, Adhikari  S, Kaya  D, Islam  MA, Malla  B, Sherchan  SP, et al. Monkeypox outbreak: Wastewater and environmental surveillance perspective. Sci Total Environ. 2023;856:159166. DOIPubMedGoogle Scholar
  10. Nelson  B. What poo tells us: wastewater surveillance comes of age amid covid, monkeypox, and polio. BMJ. 2022;378:o1869. DOIPubMedGoogle Scholar
  11. Fumian  TM, Leite  JP, Castello  AA, Gaggero  A, Caillou  MS, Miagostovich  MP. Detection of rotavirus A in sewage samples using multiplex qPCR and an evaluation of the ultracentrifugation and adsorption-elution methods for virus concentration. J Virol Methods. 2010;170:42–6. DOIPubMedGoogle Scholar

Top

Figures
Table

Top

Cite This Article

DOI: 10.3201/eid2911.230096

Original Publication Date: October 01, 2023

1These authors contributed equally to this article.

Table of Contents – Volume 29, Number 11—November 2023

EID Search Options
presentation_01 Advanced Article Search – Search articles by author and/or keyword.
presentation_01 Articles by Country Search – Search articles by the topic country.
presentation_01 Article Type Search – Search articles by article type and issue.

Top

Comments

Please use the form below to submit correspondence to the authors or contact them at the following address:

Aldo Gaggero, Laboratorio de Virología Ambiental, Programa de Virología, Instituto de Ciencias Biomédicas, Facultad de Medicina, Universidad de Chile, Independencia 1027, 8380000 Santiago, Chile

Send To

10000 character(s) remaining.

Top

Page created: September 08, 2023
Page updated: October 23, 2023
Page reviewed: October 23, 2023
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external