Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link
Volume 29, Number 5—May 2023
Dispatch

Borrelia miyamotoi Infection in Immunocompromised Man, California, USA, 2021

Luis Alberto RubioComments to Author , Anne M. Kjemtrup, Grace E. Marx, Shanna Cronan, Christopher Kilonzo, Megan E.M. Saunders, Jamie L. Choat, Elizabeth A. Dietrich, Kelly A. Liebman, and Sarah Y. Park
Author affiliations: University of California, San Francisco, San Francisco, California, USA (L.A. Rubio); California Department of Public Health, Sacramento, California, USA (A.M. Kjemtrup); Centers for Disease Control and Prevention, Fort Collins, Colorado, USA (G.E. Marx, J.L. Choat, E.A. Dietrich); County of Marin Department of Health and Human Services, San Rafael, California, USA (S. Cronan); California Department of Public Health, Richmond, California, USA (C. Kilonzo, M.E.M. Saunders); Marin-Sonoma Mosquito and Vector Control District, Cotati, California, USA (K.A. Liebman); Karius, Incorporated, Redwood City, California, USA (S.Y. Park)

Main Article

Table 2

Primers used to amplify genes for multilocus sequencing of Borrelia miyamotoi that infected immunocompromised man in California, 2021*

Gene Forward primer, 3′ → 5′ Reverse primer, 5′ → 3′
clpA TTGATCTCTTAGATGATCTTGG CAAACATAAACCTTTTCAGCCTTTAATA
clpX TTATCTGTTGCTGTTTATAATC TTCAAACATAACATCTTTAAGTAATTCTTC
nifS GAAAAAGTAAACTCCCTCAGAARGG CAATGATGCCTGCAATATTTGGTG
pepX AGAGACTTAAATTTAGCAGGAGTTG TGCATTCCCCACATTGGAGTTC
pyrG TTTAGTAATTGAGATTGGTGGTAC TATTCCACAAACATTACGAGC
recG TAGCATTCCTTTAGTTGAGGC CTCAGCATGCTCAACTACC
rplB AACTTATAGGCCAAAAACTTC GATACAGGATGACGACCACC
uvrA TTAAATTTTTAATTGATGTTGGACT TCTGTAAAAAACCCAACATAAGTTGC

*Genes derived from (6), with modifications to the nifS and rplB forward primers to make them more specific for B. miyamotoi.

Main Article

References
  1. Padgett  K, Bonilla  D, Kjemtrup  A, Vilcins  IM, Yoshimizu  MH, Hui  L, et al. Large scale spatial risk and comparative prevalence of Borrelia miyamotoi and Borrelia burgdorferi sensu lato in Ixodes pacificus. PLoS One. 2014;9:e110853. DOIPubMedGoogle Scholar
  2. Sato  K, Takano  A, Konnai  S, Nakao  M, Ito  T, Koyama  K, et al. Human infections with Borrelia miyamotoi, Japan. Emerg Infect Dis. 2014;20:1391–3. DOIPubMedGoogle Scholar
  3. Brummitt  SI, Kjemtrup  AM, Harvey  DJ, Petersen  JM, Sexton  C, Replogle  A, et al. Borrelia burgdorferi and Borrelia miyamotoi seroprevalence in California blood donors. PLoS One. 2020;15:e0243950. DOIPubMedGoogle Scholar
  4. Krause  PJ, Carroll  M, Fedorova  N, Brancato  J, Dumouchel  C, Akosa  F, et al. Human Borrelia miyamotoi infection in California: Serodiagnosis is complicated by multiple endemic Borrelia species. PLoS One. 2018;13:e0191725. DOIPubMedGoogle Scholar
  5. Dietrich  EA, Replogle  AJ, Sheldon  SW, Petersen  JM. Simultaneous detection and differentiation of clinically relevant relapsing fever Borrelia with semimultiplex real-time PCR. J Clin Microbiol. 2021;59:e0298120. DOIPubMedGoogle Scholar
  6. Margos  G, Gatewood  AG, Aanensen  DM, Hanincová  K, Terekhova  D, Vollmer  SA, et al. MLST of housekeeping genes captures geographic population structure and suggests a European origin of Borrelia burgdorferi. Proc Natl Acad Sci U S A. 2008;105:8730–5. DOIPubMedGoogle Scholar
  7. Kingry  LC, Replogle  A, Dolan  M, Sexton  C, Padgett  KA, Schriefer  ME. Chromosome and large linear plasmid sequences of a Borrelia miyamotoi strain isolated from Ixodes pacificus ticks from California. Genome Announc. 2017;5:e00960–17. DOIPubMedGoogle Scholar
  8. Barbour  AG, Bunikis  J, Travinsky  B, Hoen  AG, Diuk-Wasser  MA, Fish  D, et al. Niche partitioning of Borrelia burgdorferi and Borrelia miyamotoi in the same tick vector and mammalian reservoir species. Am J Trop Med Hyg. 2009;81:1120–31. DOIPubMedGoogle Scholar
  9. Krause  PJ, Fish  D, Narasimhan  S, Barbour  AG. Borrelia miyamotoi infection in nature and in humans. Clin Microbiol Infect. 2015;21:631–9. DOIPubMedGoogle Scholar
  10. Fleshman  AC, Foster  E, Maes  SE, Eisen  RJ. Reported county-level distribution of seven human pathogens detected in host-seeking Ixodes scapularis and Ixodes pacificus (Acari: Ixodidae) in the contiguous United States. J Med Entomol. 2022;59:1328–35. DOIPubMedGoogle Scholar
  11. Wright  WF, Simner  PJ, Carroll  KC, Auwaerter  PG. Progress report: next-generation sequencing, multiplex polymerase chain reaction, and broad-range molecular assays as diagnostic tools for fever of unknown origin investigations in adults. Clin Infect Dis. 2022;74:924–32. DOIPubMedGoogle Scholar
  12. Haidar  G, Singh  N. Fever of unknown origin. N Engl J Med. 2022;386:463–77. DOIPubMedGoogle Scholar
  13. Boden  K, Lobenstein  S, Hermann  B, Margos  G, Fingerle  V. Borrelia miyamotoi–associated neuroborreliosis in immunocompromised person. Emerg Infect Dis. 2016;22:1617–20. DOIPubMedGoogle Scholar

Main Article

Page created: April 12, 2023
Page updated: April 19, 2023
Page reviewed: April 19, 2023
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external