Volume 29, Number 9—September 2023
Research
Molecular Characterization of Circulating Yellow Fever Viruses from Outbreak in Ghana, 2021–2022
Table 1
Details of PCR testing and sequence analysis from study of yellow fever in Ghana, 2021–2022*
Virus | Reagent kit | Cycles | Primer sequences, 5′ → 3′ | Target gene | Amplicon length, bp |
---|---|---|---|---|---|
Lassa virus |
QIAGEN OneStep RT-PCR |
45 | 36E2:ACCGGGGATCCTAGGCATTT | 5′ UTR/GPC |
320 |
LVS-339-rev:GTTCTTTGTGCAGGAMAGGGGCATKGTCAT |
|||||
YFV | QIAGEN/Ambion OneStep rRT-PCR |
45 | RF:AAATCCTGKGTGCTAATTGAGGTGYATTGG | ||
RR:ACATDWTCTGGTCARTTCTCTGCTAATCGC | |||||
RProbe: gCAAATCgAgTTgCTAggCAATAAACACATT[BHQdT]g[THF]A
[FAMdT] TAATTTTRATCgTTC -Ph |
|||||
Filovirus | QIAGEN Filo OneStep RT-PCR |
45 | FiloA2.2:AAGCCTTTCCTAGCAACATGATGGT | L | 290 |
FiloA2.3:AAGCATTCCCTAGCAACATGATGGT | |||||
FiloA2.4:AAGCATTTCCTAGCAATATGATGGT | |||||
FiloA2.4:AAGCATTTCCTAGCAATATGATGGT | |||||
Filo B-Ra:GTGAGGAGGGCTATAAAAGTCACTGACATG |
|||||
Trioplex (12) | |||||
Dengue | Invitrogen Superscript III Platinum OneStep qRT-PCR | 45 | NA | C | 171 |
CHIKV | E1 | 208 | |||
Zika | NS5 | 209 |
*QIAGEN, http://www.qiagen.com; Invitrogen, Thermo Fisher, https://www.thermofisher.com. CHIKV, chikungunya virus; RT-PCR, reverse transcription PCR; qRT-PCR, quantitative RT-PCR; YFV, yellow fever virus.
References
- World Health Organization. Yellow fever [cited 2021 Nov 12]. https://www.who.int/news-room/fact-sheets/detail/yellow-fever
- Barrett ADT, Weaver SC. Arboviruses: alphaviruses, flaviviruses and bunyaviruses: encephalitis; yellow fever; dengue; haemorrhagic fever; miscellaneous tropical fevers; undifferentiated fever. In: Greenwood D, Barer M, Slack R, Irving W, editors. Medical microbiology: eighteenth edition. London: Churchill Livingstone; 2012.
- Gardner CL, Ryman KD. Yellow fever: a reemerging threat. Clin Lab Med. 2010;30:237–60. DOIPubMedGoogle Scholar
- Tolle MA. Mosquito-borne diseases. Curr Probl Pediatr Adolesc Health Care. 2009;39:97–140. DOIPubMedGoogle Scholar
- Scott DE. Epidemic disease in Ghana, 1901–1960. London: Oxford University Press; 1965.
- Agadzi VK, Boatin BA, Appawu MA, Mingle JAA, Addy PA. Yellow fever in Ghana, 1977-80. Bull World Health Organ. 1984;62:577–83.PubMedGoogle Scholar
- Fresh yellow fever claims 3 lives in West Gonja [cited 2022 Mar 23]. https://www.modernghana.com/news/666626/fresh-yellow-fever-outbreak-claims-3-lives-in-west-gonja.html
- Bonney JH, Asigbee TW, Kotey E, Attiku K, Asiedu-Bekoe F, Mawuli G, et al. Molecular detection of viral pathogens from suspected viral hemorrhagic fever patients in Ghana. Health Sciences Investigations Journal. 2020;1:31–5. DOIGoogle Scholar
- Escadafal C, Faye O, Sall AA, Faye O, Weidmann M, Strohmeier O, et al. Rapid molecular assays for the detection of yellow fever virus in low-resource settings. PLoS Negl Trop Dis. 2014;8:
e2730 . DOIPubMedGoogle Scholar - Towner JS, Rollin PE, Bausch DG, Sanchez A, Crary SM, Vincent M, et al. Rapid diagnosis of Ebola hemorrhagic fever by reverse transcription-PCR in an outbreak setting and assessment of patient viral load as a predictor of outcome. J Virol. 2004;78:4330–41. DOIPubMedGoogle Scholar
- Drosten C, Göttig S, Schilling S, Asper M, Panning M, Schmitz H, et al. Rapid detection and quantification of RNA of Ebola and Marburg viruses, Lassa virus, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, dengue virus, and yellow fever virus by real-time reverse transcription-PCR. J Clin Microbiol. 2002;40:2323–30. DOIPubMedGoogle Scholar
- Santiago GA, Vázquez J, Courtney S, Matías KY, Andersen LE, Colón C, et al. Performance of the Trioplex real-time RT-PCR assay for detection of Zika, dengue, and chikungunya viruses. Nat Commun. 2018;9:1391. DOIPubMedGoogle Scholar
- Blackley DJ, Wiley MR, Ladner JT, Fallah M, Lo T, Gilbert ML, et al. Reduced evolutionary rate in reemerged Ebola virus transmission chains. Sci Adv. 2016;2:
e1600378 . DOIPubMedGoogle Scholar - Prjibelski A, Antipov D, Meleshko D, Lapidus A, Korobeynikov A. Using SPAdes de novo assembler. Curr Protoc Bioinformatics. 2020;70:
e102 . DOIPubMedGoogle Scholar - Langmead B, Salzberg SL. Fast gapped-read alignment with Bowtie 2. Nat Methods. 2012;9:357–9. DOIPubMedGoogle Scholar
- Kumar S, Stecher G, Li M, Knyaz C, Tamura K. MEGA X: molecular evolutionary genetics analysis across computing platforms. Mol Biol Evol. 2018;35:1547–9. DOIPubMedGoogle Scholar
- Kalyaanamoorthy S, Minh BQ, Wong TKF, von Haeseler A, Jermiin LS. ModelFinder: fast model selection for accurate phylogenetic estimates. Nat Methods. 2017;14:587–9. DOIPubMedGoogle Scholar
- World Health Organization. Yellow fever laboratory diagnostic testing in Africa [cited 2022 Mar 23]. https://apps.who.int/iris/bitstream/handle/10665/246226/who-ohe-yf-lab-16.1-eng.pdf
- Stock NK, Laraway H, Faye O, Diallo M, Niedrig M, Sall AA. Biological and phylogenetic characteristics of yellow fever virus lineages from West Africa. J Virol. 2013;87:2895–907. DOIPubMedGoogle Scholar
- Global health security agenda [cited 2022 Mar 26]. https://globalhealthsecurityagenda.org
- International Federation of Red Cross and Red Crescent Societies. Yellow fever outbreak—Disaster Relief Emergency Fund operation no. MDRGH005 [cited 2022 Mar 26]. https://reliefweb.int/report/ghana/yellow-fever-outbreak-dref-operation-n°-mdrgh005
- Nwaiwu AU, Musekiwa A, Tamuzi JL, Sambala EZ, Nyasulu PS. The incidence and mortality of yellow fever in Africa: a systematic review and meta-analysis. BMC Infect Dis. 2021;21:1089. DOIPubMedGoogle Scholar
- Bonney JHK, Osei-Kwasi M, Adiku TK, Barnor JS, Amesiya R, Kubio C, et al. Hospital-based surveillance for viral hemorrhagic fevers and hepatitides in Ghana. PLoS Negl Trop Dis. 2013;7:
e2435 . DOIPubMedGoogle Scholar - Kwagonza L, Masiira B, Kyobe-Bosa H, Kadobera D, Atuheire EB, Lubwama B, et al. Outbreak of yellow fever in central and southwestern Uganda, February-may 2016. BMC Infect Dis. 2018;18:548. DOIPubMedGoogle Scholar
- Johansson MA, Vasconcelos PFC, Staples JE. The whole iceberg: estimating the incidence of yellow fever virus infection from the number of severe cases. Trans R Soc Trop Med Hyg. 2014;108:482–7. DOIPubMedGoogle Scholar
- Mutebi JP, Barrett AD. The epidemiology of yellow fever in Africa. Microbes Infect. 2002;4:1459–68. DOIPubMedGoogle Scholar
- Barrett AD, Monath TP. Epidemiology and ecology of yellow fever virus. Adv Virus Res. 2003;61:291–315. DOIPubMedGoogle Scholar
- de Souza RP, Foster PG, Sallum MA, Coimbra TL, Maeda AY, Silveira VR, et al. Detection of a new yellow fever virus lineage within the South American genotype I in Brazil. J Med Virol. 2010;82:175–85. DOIPubMedGoogle Scholar
- Mutebi JP, Wang H, Li L, Bryant JE, Barrett AD. Phylogenetic and evolutionary relationships among yellow fever virus isolates in Africa. J Virol. 2001;75:6999–7008. DOIPubMedGoogle Scholar
- von Lindern JJ, Aroner S, Barrett ND, Wicker JA, Davis CT, Barrett ADT. Genome analysis and phylogenetic relationships between east, central and west African isolates of Yellow fever virus. J Gen Virol. 2006;87:895–907. DOIPubMedGoogle Scholar
Page created: July 20, 2023
Page updated: September 07, 2023
Page reviewed: September 07, 2023
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.