Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link

Volume 29, Number 9—September 2023

Research

Molecular Characterization of Circulating Yellow Fever Viruses from Outbreak in Ghana, 2021–2022

Joseph Humphrey Kofi BonneyComments to Author , Terrel Sanders, Deborah Pratt, Bright Agbodzi, Dennis Laryea, Nana Kwame Fredua Agyeman, Selassie Kumordjie, Keren Attiku, Patience Lartekai Adams, Gideon Aning Boateng, Sally-Ann Ohene, Christopher Tamal, Gifty Mawuli, Clara Yeboah, Samuel Dadzie, Chrysantus Kubio, Franklin Asiedu-Bekoe, and John Kofi OdoomComments to Author 
Author affiliations: Noguchi Memorial Institute for Medical Research Virology Department, Legon Accra, Ghana (J.H.K. Bonney, D. Pratt, K. Attiku, P.L. Adams, G.A. Boateng, G. Mawuli, J.K. Odoom); US Naval Medical Research Unit, No. 3, Ghana Detachment, Accra, Ghana (T. Sanders, B. Agbodzi, S. Kumordjie, C. Yeboah); Ghana Health Service Public Health Unit, Accra (D. Laryea, N.K.F. Agyeman, F. Asiedu-Bekoe); World Health Organization Ghana Country Office, Accra (S.-A. Ohene, C. Tamal); Noguchi Memorial Institute for Medical Research Department of Parasitology, Legon Accra (S. Dadzie); Ghana Health Service–Savannah Regional Health Directorate, Damongo, Ghana (C. Kubio)

Main Article

Table 1

Details of PCR testing and sequence analysis from study of yellow fever in Ghana, 2021–2022*

Virus Reagent kit Cycles Primer sequences, 5′ → 3′ Target gene Amplicon length, bp
Lassa virus
QIAGEN OneStep RT-PCR
45 36E2:ACCGGGGATCCTAGGCATTT 5′ UTR/GPC
320

LVS-339-rev:GTTCTTTGTGCAGGAMAGGGGCATKGTCAT

YFV QIAGEN/Ambion OneStep rRT-PCR
45 RF:AAATCCTGKGTGCTAATTGAGGTGYATTGG
RR:ACATDWTCTGGTCARTTCTCTGCTAATCGC


RProbe: gCAAATCgAgTTgCTAggCAATAAACACATT[BHQdT]g[THF]A
[FAMdT] TAATTTTRATCgTTC -Ph


Filovirus QIAGEN Filo OneStep RT-PCR
45 FiloA2.2:AAGCCTTTCCTAGCAACATGATGGT L 290
FiloA2.3:AAGCATTCCCTAGCAACATGATGGT
FiloA2.4:AAGCATTTCCTAGCAATATGATGGT
FiloA2.4:AAGCATTTCCTAGCAATATGATGGT


Filo B-Ra:GTGAGGAGGGCTATAAAAGTCACTGACATG


Trioplex (12)
Dengue Invitrogen Superscript III Platinum OneStep qRT-PCR 45 NA C 171
CHIKV E1 208
Zika NS5 209

*QIAGEN, http://www.qiagen.com; Invitrogen, Thermo Fisher, https://www.thermofisher.com. CHIKV, chikungunya virus; RT-PCR, reverse transcription PCR; qRT-PCR, quantitative RT-PCR; YFV, yellow fever virus.

Main Article

References
  1. World Health Organization. Yellow fever [cited 2021 Nov 12]. https://www.who.int/news-room/fact-sheets/detail/yellow-fever
  2. Barrett  ADT, Weaver  SC. Arboviruses: alphaviruses, flaviviruses and bunyaviruses: encephalitis; yellow fever; dengue; haemorrhagic fever; miscellaneous tropical fevers; undifferentiated fever. In: Greenwood D, Barer M, Slack R, Irving W, editors. Medical microbiology: eighteenth edition. London: Churchill Livingstone; 2012.
  3. Gardner  CL, Ryman  KD. Yellow fever: a reemerging threat. Clin Lab Med. 2010;30:237–60. DOIPubMedGoogle Scholar
  4. Tolle  MA. Mosquito-borne diseases. Curr Probl Pediatr Adolesc Health Care. 2009;39:97–140. DOIPubMedGoogle Scholar
  5. Scott  DE. Epidemic disease in Ghana, 1901–1960. London: Oxford University Press; 1965.
  6. Agadzi  VK, Boatin  BA, Appawu  MA, Mingle  JAA, Addy  PA. Yellow fever in Ghana, 1977-80. Bull World Health Organ. 1984;62:577–83.PubMedGoogle Scholar
  7. Fresh yellow fever claims 3 lives in West Gonja [cited 2022 Mar 23]. https://www.modernghana.com/news/666626/fresh-yellow-fever-outbreak-claims-3-lives-in-west-gonja.html
  8. Bonney  JH, Asigbee  TW, Kotey  E, Attiku  K, Asiedu-Bekoe  F, Mawuli  G, et al. Molecular detection of viral pathogens from suspected viral hemorrhagic fever patients in Ghana. Health Sciences Investigations Journal. 2020;1:31–5. DOIGoogle Scholar
  9. Escadafal  C, Faye  O, Sall  AA, Faye  O, Weidmann  M, Strohmeier  O, et al. Rapid molecular assays for the detection of yellow fever virus in low-resource settings. PLoS Negl Trop Dis. 2014;8:e2730. DOIPubMedGoogle Scholar
  10. Towner  JS, Rollin  PE, Bausch  DG, Sanchez  A, Crary  SM, Vincent  M, et al. Rapid diagnosis of Ebola hemorrhagic fever by reverse transcription-PCR in an outbreak setting and assessment of patient viral load as a predictor of outcome. J Virol. 2004;78:4330–41. DOIPubMedGoogle Scholar
  11. Drosten  C, Göttig  S, Schilling  S, Asper  M, Panning  M, Schmitz  H, et al. Rapid detection and quantification of RNA of Ebola and Marburg viruses, Lassa virus, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, dengue virus, and yellow fever virus by real-time reverse transcription-PCR. J Clin Microbiol. 2002;40:2323–30. DOIPubMedGoogle Scholar
  12. Santiago  GA, Vázquez  J, Courtney  S, Matías  KY, Andersen  LE, Colón  C, et al. Performance of the Trioplex real-time RT-PCR assay for detection of Zika, dengue, and chikungunya viruses. Nat Commun. 2018;9:1391. DOIPubMedGoogle Scholar
  13. Blackley  DJ, Wiley  MR, Ladner  JT, Fallah  M, Lo  T, Gilbert  ML, et al. Reduced evolutionary rate in reemerged Ebola virus transmission chains. Sci Adv. 2016;2:e1600378. DOIPubMedGoogle Scholar
  14. Prjibelski  A, Antipov  D, Meleshko  D, Lapidus  A, Korobeynikov  A. Using SPAdes de novo assembler. Curr Protoc Bioinformatics. 2020;70:e102. DOIPubMedGoogle Scholar
  15. Langmead  B, Salzberg  SL. Fast gapped-read alignment with Bowtie 2. Nat Methods. 2012;9:357–9. DOIPubMedGoogle Scholar
  16. Kumar  S, Stecher  G, Li  M, Knyaz  C, Tamura  K. MEGA X: molecular evolutionary genetics analysis across computing platforms. Mol Biol Evol. 2018;35:1547–9. DOIPubMedGoogle Scholar
  17. Kalyaanamoorthy  S, Minh  BQ, Wong  TKF, von Haeseler  A, Jermiin  LS. ModelFinder: fast model selection for accurate phylogenetic estimates. Nat Methods. 2017;14:587–9. DOIPubMedGoogle Scholar
  18. World Health Organization. Yellow fever laboratory diagnostic testing in Africa [cited 2022 Mar 23]. https://apps.who.int/iris/bitstream/handle/10665/246226/who-ohe-yf-lab-16.1-eng.pdf
  19. Stock  NK, Laraway  H, Faye  O, Diallo  M, Niedrig  M, Sall  AA. Biological and phylogenetic characteristics of yellow fever virus lineages from West Africa. J Virol. 2013;87:2895–907. DOIPubMedGoogle Scholar
  20. Global health security agenda [cited 2022 Mar 26]. https://globalhealthsecurityagenda.org
  21. International Federation of Red Cross and Red Crescent Societies. Yellow fever outbreak—Disaster Relief Emergency Fund operation no. MDRGH005 [cited 2022 Mar 26]. https://reliefweb.int/report/ghana/yellow-fever-outbreak-dref-operation-n°-mdrgh005
  22. Nwaiwu  AU, Musekiwa  A, Tamuzi  JL, Sambala  EZ, Nyasulu  PS. The incidence and mortality of yellow fever in Africa: a systematic review and meta-analysis. BMC Infect Dis. 2021;21:1089. DOIPubMedGoogle Scholar
  23. Bonney  JHK, Osei-Kwasi  M, Adiku  TK, Barnor  JS, Amesiya  R, Kubio  C, et al. Hospital-based surveillance for viral hemorrhagic fevers and hepatitides in Ghana. PLoS Negl Trop Dis. 2013;7:e2435. DOIPubMedGoogle Scholar
  24. Kwagonza  L, Masiira  B, Kyobe-Bosa  H, Kadobera  D, Atuheire  EB, Lubwama  B, et al. Outbreak of yellow fever in central and southwestern Uganda, February-may 2016. BMC Infect Dis. 2018;18:548. DOIPubMedGoogle Scholar
  25. Johansson  MA, Vasconcelos  PFC, Staples  JE. The whole iceberg: estimating the incidence of yellow fever virus infection from the number of severe cases. Trans R Soc Trop Med Hyg. 2014;108:482–7. DOIPubMedGoogle Scholar
  26. Mutebi  JP, Barrett  AD. The epidemiology of yellow fever in Africa. Microbes Infect. 2002;4:1459–68. DOIPubMedGoogle Scholar
  27. Barrett  AD, Monath  TP. Epidemiology and ecology of yellow fever virus. Adv Virus Res. 2003;61:291–315. DOIPubMedGoogle Scholar
  28. de Souza  RP, Foster  PG, Sallum  MA, Coimbra  TL, Maeda  AY, Silveira  VR, et al. Detection of a new yellow fever virus lineage within the South American genotype I in Brazil. J Med Virol. 2010;82:175–85. DOIPubMedGoogle Scholar
  29. Mutebi  JP, Wang  H, Li  L, Bryant  JE, Barrett  AD. Phylogenetic and evolutionary relationships among yellow fever virus isolates in Africa. J Virol. 2001;75:6999–7008. DOIPubMedGoogle Scholar
  30. von Lindern  JJ, Aroner  S, Barrett  ND, Wicker  JA, Davis  CT, Barrett  ADT. Genome analysis and phylogenetic relationships between east, central and west African isolates of Yellow fever virus. J Gen Virol. 2006;87:895–907. DOIPubMedGoogle Scholar

Main Article

Page created: July 20, 2023
Page updated: September 07, 2023
Page reviewed: September 07, 2023
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external