Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link

Volume 30, Number 12—December 2024

Dispatch

Ehrlichia canis in Human and Tick, Italy, 2023

Giovanni SgroiComments to Author , Nicola D’Alessio, Vincenzo Veneziano, Giuseppe Rofrano, Giovanna Fusco, Mariaelisa Carbonara, Filipe Dantas-Torres, Domenico Otranto, and Roberta Iatta
Author affiliation: Experimental Zooprophylactic Institute of Southern Italy, Portici, Italy (G. Sgroi, N. D’Alessio, G. Rofrano, G. Fusco), University of Naples Federico II, Naples, Italy (V. Veneziano), University of Bari Aldo Moro, Bari, Italy (M. Carbonara, D. Otranto, R. Iatta), Aggeu Magalhães Institute, Recife, Brazil (F. Dantas-Torres); City University of Hong Kong, Hong Kong Special Administrative Region, People’s Republic of China (D. Otranto)

Main Article

Table 1

Targeted pathogens and related PCR protocols used in study of Ehrlichia canis in human and tick, Italy, 2023

Pathogen Target gene Primer
name
Primer sequence, 5′→3′ Amplicon length, bp Reference
Anaplasma, Ehrlichia, Candidatus Neoehrlichia spp. 16S rRNA EHR16-SD
EHR16-SR
GGTACCYACAGAAGAAGTCC
TAGCACTCATCGTTTACAGC
345 (8)
Ehrlichia canis groEL Ehr-groel-F
Ehr-groel-R
GTTGAAAARACTGATGGTATGCA
ACACGRTCTTTACGYTCYTTAAC
590 (9)
Babesia, Theileria spp. 18S rRNA RLB-F
RLB-R
GAGGTAGTGACAAGAAATAACAATA
TCTTCGATCCCCTAACTTTC
460–520 (8)
Borrelia burgdorferi sensu lato complex Flagellin FLA1
FLA2
AGAGCAACTTACAGACGAAATTAAT CAAGTCTATTTTGGAAAGCACCTAA 482 (8)
Coxiella burnetii IS1111a Trans-1
Trans-2
TATGTATCCACCGTAGCCAGT
CCCAACAACACCTCCTTATTC
687 (8)
Rickettsia spp. gltA CS-78F
CS-323R
GCAAGTATCGGTGAGGATGTAAT
GCTTCCTTAAAATTCAATAAATCAGGAT
401 (8)

Main Article

References
  1. Mylonakis  ME, Harrus  S, Breitschwerdt  EB. An update on the treatment of canine monocytic ehrlichiosis (Ehrlichia canis). Vet J. 2019;246:45–53. DOIPubMedGoogle Scholar
  2. Maeda  K, Markowitz  N, Hawley  RC, Ristic  M, Cox  D, McDade  JE. Human infection with Ehrlichia canis, a leukocytic rickettsia. N Engl J Med. 1987;316:853–6. DOIPubMedGoogle Scholar
  3. Ewing  SA, Johnson  EM, Kocan  KM. Human infection with Ehrlichia canis. N Engl J Med. 1987;317:899–900. DOIPubMedGoogle Scholar
  4. Perez  M, Rikihisa  Y, Wen  B. Ehrlichia canis-like agent isolated from a man in Venezuela: antigenic and genetic characterization. J Clin Microbiol. 1996;34:2133–9. DOIPubMedGoogle Scholar
  5. Perez  M, Bodor  M, Zhang  C, Xiong  Q, Rikihisa  Y. Human infection with Ehrlichia canis accompanied by clinical signs in Venezuela. Ann N Y Acad Sci. 2006;1078:110–7. DOIPubMedGoogle Scholar
  6. Bouza-Mora  L, Dolz  G, Solórzano-Morales  A, Romero-Zuñiga  JJ, Salazar-Sánchez  L, Labruna  MB, et al. Novel genotype of Ehrlichia canis detected in samples of human blood bank donors in Costa Rica. Ticks Tick Borne Dis. 2017;8:36–40. DOIPubMedGoogle Scholar
  7. Otranto  D, Dantas-Torres  F, Giannelli  A, Latrofa  MS, Cascio  A, Cazzin  S, et al. Ticks infesting humans in Italy and associated pathogens. Parasit Vectors. 2014;7:328. DOIPubMedGoogle Scholar
  8. Sgroi  G, Iatta  R, Lia  RP, D’Alessio  N, Manoj  RRS, Veneziano  V, et al. Spotted fever group rickettsiae in Dermacentor marginatus from wild boars in Italy. Transbound Emerg Dis. 2021;68:2111–20. DOIPubMedGoogle Scholar
  9. Cicculli  V, Masse  S, Capai  L, de Lamballerie  X, Charrel  R, Falchi  A. First detection of Ehrlichia minasensis in Hyalomma marginatum ticks collected from cattle in Corsica, France. Vet Med Sci. 2019;5:243–8. DOIPubMedGoogle Scholar
  10. Nei  M, Kumar  S. Molecular evolution and phylogenetics. New York: Oxford University Press; 2000.
  11. Kumar  S, Stecher  G, Li  M, Knyaz  C, Tamura  K. MEGA X: Molecular Evolutionary Genetics Analysis across computing platforms. Mol Biol Evol. 2018;35:1547–9. DOIPubMedGoogle Scholar
  12. Dantas-Torres  F, Otranto  D. Species diversity and abundance of ticks in three habitats in southern Italy. Ticks Tick Borne Dis. 2013;4:251–5. DOIPubMedGoogle Scholar
  13. Chisu  V, Foxi  C, Mannu  R, Satta  G, Masala  G. A five-year survey of tick species and identification of tick-borne bacteria in Sardinia, Italy. Ticks Tick Borne Dis. 2018;9:678–81. DOIPubMedGoogle Scholar
  14. Bezerra-Santos  MA, Nguyen  VL, Iatta  R, Manoj  RRS, Latrofa  MS, Hodžić  A, et al. Genetic variability of Ehrlichia canis TRP36 in ticks, dogs, and red foxes from Eurasia. Vet Microbiol. 2021;255:109037. DOIPubMedGoogle Scholar
  15. Centers for Disease Control and Prevention. Tickborne diseases of the US: a reference manual for health care providers, 6th edition. Colorado (CO); The Centers; 2022.

Main Article

Page created: October 25, 2024
Page updated: November 26, 2024
Page reviewed: November 26, 2024
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external