Volume 30, Number 12—December 2024
Dispatch
Ehrlichia canis in Human and Tick, Italy, 2023
Table 1
Targeted pathogens and related PCR protocols used in study of Ehrlichia canis in human and tick, Italy, 2023
| Pathogen | Target gene | Primer name |
Primer sequence, 5′→3′ | Amplicon length, bp | Reference |
|---|---|---|---|---|---|
| Anaplasma, Ehrlichia, Candidatus Neoehrlichia spp. | 16S rRNA | EHR16-SD EHR16-SR |
GGTACCYACAGAAGAAGTCC TAGCACTCATCGTTTACAGC |
345 | (8) |
| Ehrlichia canis | groEL | Ehr-groel-F Ehr-groel-R |
GTTGAAAARACTGATGGTATGCA ACACGRTCTTTACGYTCYTTAAC |
590 | (9) |
| Babesia, Theileria spp. | 18S rRNA | RLB-F RLB-R |
GAGGTAGTGACAAGAAATAACAATA TCTTCGATCCCCTAACTTTC |
460–520 | (8) |
| Borrelia burgdorferi sensu lato complex | Flagellin | FLA1 FLA2 |
AGAGCAACTTACAGACGAAATTAAT CAAGTCTATTTTGGAAAGCACCTAA | 482 | (8) |
| Coxiella burnetii | IS1111a | Trans-1 Trans-2 |
TATGTATCCACCGTAGCCAGT CCCAACAACACCTCCTTATTC |
687 | (8) |
| Rickettsia spp. | gltA | CS-78F CS-323R |
GCAAGTATCGGTGAGGATGTAAT GCTTCCTTAAAATTCAATAAATCAGGAT |
401 | (8) |
References
- Mylonakis ME, Harrus S, Breitschwerdt EB. An update on the treatment of canine monocytic ehrlichiosis (Ehrlichia canis). Vet J. 2019;246:45–53. DOIPubMedGoogle Scholar
- Maeda K, Markowitz N, Hawley RC, Ristic M, Cox D, McDade JE. Human infection with Ehrlichia canis, a leukocytic rickettsia. N Engl J Med. 1987;316:853–6. DOIPubMedGoogle Scholar
- Ewing SA, Johnson EM, Kocan KM. Human infection with Ehrlichia canis. N Engl J Med. 1987;317:899–900. DOIPubMedGoogle Scholar
- Perez M, Rikihisa Y, Wen B. Ehrlichia canis-like agent isolated from a man in Venezuela: antigenic and genetic characterization. J Clin Microbiol. 1996;34:2133–9. DOIPubMedGoogle Scholar
- Perez M, Bodor M, Zhang C, Xiong Q, Rikihisa Y. Human infection with Ehrlichia canis accompanied by clinical signs in Venezuela. Ann N Y Acad Sci. 2006;1078:110–7. DOIPubMedGoogle Scholar
- Bouza-Mora L, Dolz G, Solórzano-Morales A, Romero-Zuñiga JJ, Salazar-Sánchez L, Labruna MB, et al. Novel genotype of Ehrlichia canis detected in samples of human blood bank donors in Costa Rica. Ticks Tick Borne Dis. 2017;8:36–40. DOIPubMedGoogle Scholar
- Otranto D, Dantas-Torres F, Giannelli A, Latrofa MS, Cascio A, Cazzin S, et al. Ticks infesting humans in Italy and associated pathogens. Parasit Vectors. 2014;7:328. DOIPubMedGoogle Scholar
- Sgroi G, Iatta R, Lia RP, D’Alessio N, Manoj RRS, Veneziano V, et al. Spotted fever group rickettsiae in Dermacentor marginatus from wild boars in Italy. Transbound Emerg Dis. 2021;68:2111–20. DOIPubMedGoogle Scholar
- Cicculli V, Masse S, Capai L, de Lamballerie X, Charrel R, Falchi A. First detection of Ehrlichia minasensis in Hyalomma marginatum ticks collected from cattle in Corsica, France. Vet Med Sci. 2019;5:243–8. DOIPubMedGoogle Scholar
- Nei M, Kumar S. Molecular evolution and phylogenetics. New York: Oxford University Press; 2000.
- Kumar S, Stecher G, Li M, Knyaz C, Tamura K. MEGA X: Molecular Evolutionary Genetics Analysis across computing platforms. Mol Biol Evol. 2018;35:1547–9. DOIPubMedGoogle Scholar
- Dantas-Torres F, Otranto D. Species diversity and abundance of ticks in three habitats in southern Italy. Ticks Tick Borne Dis. 2013;4:251–5. DOIPubMedGoogle Scholar
- Chisu V, Foxi C, Mannu R, Satta G, Masala G. A five-year survey of tick species and identification of tick-borne bacteria in Sardinia, Italy. Ticks Tick Borne Dis. 2018;9:678–81. DOIPubMedGoogle Scholar
- Bezerra-Santos MA, Nguyen VL, Iatta R, Manoj RRS, Latrofa MS, Hodžić A, et al. Genetic variability of Ehrlichia canis TRP36 in ticks, dogs, and red foxes from Eurasia. Vet Microbiol. 2021;255:
109037 . DOIPubMedGoogle Scholar - Centers for Disease Control and Prevention. Tickborne diseases of the US: a reference manual for health care providers, 6th edition. Colorado (CO); The Centers; 2022.
Page created: October 25, 2024
Page updated: November 26, 2024
Page reviewed: November 26, 2024
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.