Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link

Volume 9, Number 6—June 2003

Letter

Parachlamydiaceae as Rare Agents of Pneumonia

On This Page
Article Metrics
59
citations of this article
EID Journal Metrics on Scopus

Cite This Article
Citation for Media

To the Editor: Members of the Parachlamydiaceae family are emerging intracellular bacteria living in amoebae (1,2). Serologic studies have suggested that Parachlamydia acanthamoeba might be an agent of community-acquired pneumonia transmitted from a water source (3,4). In a single occasion, 16s rRNA of a member of the Parachlamydiaceae family was amplified and sequenced from a bronchoalveolar lavage sample (5). Thus, to specify the role played by the Parachlamydiaceae as agents of lower respiratory tract infection, we developed a real-time polymerase chain reaction (PCR) assay and applied it to 1,200 bronchoalveolar lavage samples, taken mainly from patients with pneumonia of unknown cause and received in our diagnostic microbiology laboratory between 1997 and 2002.

DNA extraction was performed by using the MagNA Pure LC instrument and the MagNA Pure LC DNA Isolation Kit III (Roche Molecular Biochemicals, Mannheim, Germany). Real-time PCR was performed by using TaqMan technology and targeting the gene encoding for a nonmitochondrial ATP/ADP translocase (GenBank accession no. AF490592). This energy parasite gene is present only in rickettsiae, chlamydiae, and plant plastids (6). The master mixture was prepared from the TaqMan Universal Master Mix kit (Applied Biosystems, Foster City, CA), according to the manufacturer’s instructions, and included 200 nM of each primer (Adp81F 5´- TAGTGATCTGCTACGGGATTT, Adp84R 5´-TTGGATTAGGATATTGCAATTT) and 200 nM of the fluorescent labeled probe (6-FAM-5´-AACCTTGTAGAAGTAACCTGGAAGAACCAGC-3´-TAMRA, where 6-FAM is 6-carboxyfluorescein and TAMRA is 6-carboxytetramethylrhodamine). Amplification was carried out on the ABI 7700 sequence detection system (TaqMan system, Applied Biosystems), by running 45 cycles, with annealing temperature of 52°C and polymerization temperature of 60°C. To prevent carryover, 200 µ M of uracil triphosphate was part of the master mixture, and uracil-N-glycosylase was used systematically. Parachlamydia acanthamoeba strain Hall coccus (kindly provided by T.J. Rowbotham) (3) and sterile water were used as positive and negative controls, respectively. In addition, PCR was tested on Chlamydophila pneumoniae and Chlamydia psitacci and four strains of Rickettsia. All but one (Rickettsia montana) was negative, as were 64 sterile water controls.

Of the 1,200 broncheolar lavage samples tested, 5 (0.42%) were positive. When PCR was repeated for those five samples, four were negative for P. acanthamoeba DNA, and only one was a true positive, confirmed by sequencing the product of the additional PCR. The sequence shared 100% DNA homology with P. acanthamoeba strain Hall coccus (GenBank accession no. AF490592). The patient, a 31-year-old man who was HIV-positive, had pneumonia, cough, and no fever. Chest x-ray examination showed an opacity in the right lung and a bilateral infiltrate. Leukocyte count was 5,000/mm3 with 80 CD4 cells/mm3; microbiologic investigations (in which the bronchoalveolar lavage was examined for cytomegalovirus, Chlamydophila pneumoniae, Legionella pneumophila, Pneumocystis carinii, mycobacteria, and Toxoplasma gondii) did not identify a causal agent.

We developed a highly sensitive PCR, which could amplify as few as 10 bacteria/mL. The assay results in a relatively high specificity (1,195/1,199; 99.67%) because it uses a target gene found only in rickettsiae, chlamydiae, and plant plastids, and uses a specific DNA probe. We considerably decreased the risk of horizontal and vertical contamination of the PCR reaction by using uracil and uracil-N-glycosylase and by keeping reaction cups closed since the first amplification cycle.

More importantly, our study showed that Parachlamydia DNA is rarely found in bronchoalveolar lavage samples (0.083%). This suggests that persons are infrequently exposed to Parachlamydia organisms and, consequently, members of the Parachlamydiaceae seldom cause pneumonia in humans. In the only positive sample, whether Parachlamydia originated from bacteria in the oropharynx, from water, or from a colonization of the lower respiratory tract was not known; whether they caused the patient’s pneumonia is also not known. That two strains of Parachlamydia found in amoebae were recovered from the nasopharynx of healthy volunteers (7) favors the first hypothesis. However, that the positive broncholaveolar lavage specimen was taken from an HIV-positive patient with community-acquired pneumonia suggests that Parachlamydia might occasionally play a pathogenic role in AIDS patients. Moreover, any amoebae-associated bacteria should be considered as a potential emerging pathogen because intra-amoebal growth may lead to the selection of virulence traits and to the adaptation to professional phagocytes, such as alveolar macrophages (1,2). Further studies are warranted to determine whether Parachlamydiaceae causes community-acquired pneumonia, particularly in HIV-infected persons.

Top

Acknowledgment

We thank the Swiss National Science Foundation for funding the postodoctoral fellowship of Gilbert Greub in the Unité des Rickettsies, Marseille, France, and Olivier Castigliola for technical assistance.

Top

Gilbert Greub*, Pierre Berger*, Laurent Papazian†, and Didier Raoult*Comments to Author 
Author affiliations: *Université de la Méditerranée, Marseille, France; †Hôpital Sainte Marguerite, Marseille, France

Top

References

  1. Greub  G, Raoult  D. Parachlamydiaceae, potential emerging pathogens. Emerg Infect Dis. 2002;8:625–30.PubMedGoogle Scholar
  2. Greub  G, Raoult  D. Crescent bodies of Parachlamydia acanthamoeba and its life cycle within Acanthamoeba polyphaga: an electron micrograph study. Appl Environ Microbiol. 2002;68:3076–84. DOIPubMedGoogle Scholar
  3. Birtles  RJ, Rowbotham  TJ, Storey  C, Marrie  TJ, Raoult  D. Chlamydia-like obligate parasite of free-living amoebae. Lancet. 1997;349:925–6. DOIPubMedGoogle Scholar
  4. Marrie  TJ, Raoult  D, La Scola  B, Birtles  RJ, de Carolis  E. Legionella-like and other amoebal pathogens as agents of community-acquired pneumonia. Emerg Infect Dis. 2001;7:1026–9. DOIPubMedGoogle Scholar
  5. Corsaro  D, Venditti  D, Le Faou  A, Guglielmetti  P, Valassina  M. A new chlamydia-like 16s rDNA sequence from a clinical sample. Microbiology. 2001;147:515–6.PubMedGoogle Scholar
  6. Wolf  YI, Aravind  L, Koonin  EV. Rickettsiae and chlamydiae evidence of horizontal gene tranfer and gene exchange. Trends Genet. 1999;15:173–5. DOIPubMedGoogle Scholar
  7. Amann  R, Springer  N, Schonhuber  W, Ludwig  W, Schmid  EN, Muller  KD, Obligate intracellular bacterial parasites of Acanthamoebae related to Chlamydia spp. Appl Environ Microbiol. 1997;63:115–21.PubMedGoogle Scholar

Top

Cite This Article

DOI: 10.3201/eid0906.020613

Related Links

Top

Table of Contents – Volume 9, Number 6—June 2003

EID Search Options
presentation_01 Advanced Article Search – Search articles by author and/or keyword.
presentation_01 Articles by Country Search – Search articles by the topic country.
presentation_01 Article Type Search – Search articles by article type and issue.

Top

Comments

Please use the form below to submit correspondence to the authors or contact them at the following address:

Didier Raoult, Unité des Rickettsies, CNRS UPRESA 6020 Faculté de Médecine, Université de la Méditerranée, 27 Boulevard Jean Moulin, 13385 Marseille Cedex 05, France; fax: 00-33-491-83-03-90

Send To

10000 character(s) remaining.

Top

Page created: December 21, 2010
Page updated: December 21, 2010
Page reviewed: December 21, 2010
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external