Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link

Volume 9, Number 7—July 2003

Research

Antimicrobial Resistance Markers of Class 1 and Class 2 Integron-bearing Escherichia coli from Irrigation Water and Sediments

Matthew T. Roe*, Everardo Vega*, and Suresh D. Pillai*Comments to Author 
Author affiliations: *Texas A&M University, College Station, Texas, USA

Main Article

Table

Oligonucleotide primer sequences used for amplification of class 1 and class 2 integrase and variable regions

Primer Primer sequence Target Reference
integ-1 5'-GGCATCCAAGCAAG-3' 5'-Class 1 integron variable region Levesque et al. 1995 (13)
integ-2 5'-AAGCAGACTTGACCTGA-3' 3'-Class 1 integron variable region Levesque et al. 1995 (13)
hep51 5'-GATGCCATCGCAAGTACGAG-3' 5'-Class 2 integron variable region White et al. 2001 (14)
hep74 5'-CGG
GATCCCGGACGGCATGCACGATTT
GTA-3' 3'-Class 2 integron variable region White et al. 2001 (14)
intI1.F 5'-GGGTCAAGGATCTGGATTTCG-3' 5'-intI1 gene Mazel et al. 2000 (15)
intI1.R 5'-ACATGGGTGTAAATCATCGTC-3' 3'-intI1 gene Mazel et.al. 2000 (15)
intI2.F 5'-CACGGATATGCGACAAAAAGGT-3' 5'-intI2 gene Mazel et al. 2000 (15)
intI2.R 5'-GTAGCAAACGAGTGACGAAATG-3' 5'-intI2 gene Mazel et al. 2000 (15)

Main Article

References
  1. Ochman  H, Lawrence  JG, Groisman  EA. Lateral gene transfer and the nature of bacterial innovation. Nature. 2000;405:299–304. DOIPubMedGoogle Scholar
  2. Lucey  B, Crowley  D, Moloney  P, Cryan  B, Daly  M, O’Halloran  F, Integronlike structures in Campylobacter spp. of human and animal origin. Emerg Infect Dis. 2000;6:50–5.PubMedGoogle Scholar
  3. Zhao  S, White  DG, Ge  B, Ayers  S, Friedman  S, English  L, Identification and characterization of integron-mediated antibiotic resistance among Shiga toxin–producing Escherichia coli isolates. Appl Environ Microbiol. 2001;67:1558–64. DOIPubMedGoogle Scholar
  4. Briggs  CE, Fratamico  PM. Molecular characterization of an antibiotic resistance gene cluster of Salmonella typhimurium DT104. Antimicrob Agents Chemother. 1999;43:846–9.PubMedGoogle Scholar
  5. Mroz  RC Jr, Pillai  SD. Bacterial populations in the groundwater on the US-Mexico border in El Paso County, Texas. South Med J. 1994;87:214–7.PubMedGoogle Scholar
  6. Pillai  SD, Widmer  KW, Maciorowski  KG, Ricke  SC. Antibiotic resistance profiles of Escherichia coli isolated from rural and urban environments. J Environ Sci Health. 1997;32:1665–75. DOIGoogle Scholar
  7. International Boundary and Water Commission. Water Bulletin #63: Flow of the Rio Grande and related data. El Paso (TX): The Commission; 1993. p. 132.
  8. Scandura  JE, Sobsey  MD. Viral and bacterial contamination of groundwater from on-site sewage treatment systems. Water Sci Technol. 1997;35:141–6. DOIGoogle Scholar
  9. Rayburn  EL, Sternes  KL, Weidenfeld  RP, Pillai  SD. Microbial pathogens in irrigation canals and associated sediments. In: Proceedings of the 101st General Meeting of the American Society for Microbiology. 2001. Orlando (FL): American Society for Microbiology; 2001.
  10. Food and Drug Administration. Bacteriological analytical manual online. 8th ed. 2001. Available from: URL: http://www.cfsan.fda.gov/~ebam/bam-toc.html
  11. National Committee for Clinical Laboratory Studies. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically. Vol. 10. Villanova (PA): The Committee; 1999. p. 33.
  12. Centers for Disease Control and Prevention/Food and Drug Administration; U.S. Department of Agriculture. National Antibiotic Resistance Monitoring System. Atlanta: The Centers; 1999.
  13. Levesque  C, Piche  L, Larose  C, Roy  PH. PCR mapping of integrons reveals several novel combinations of resistance genes. Antimicrob Agents Chemother. 1995;39:185–91.PubMedGoogle Scholar
  14. White  PA, McIver  CJ, Rawlinson  WD. Integrons and gene cassettes in the enterobacteriaceae. Antimicrob Agents Chemother. 2001;45:2658–61. DOIPubMedGoogle Scholar
  15. Mazel  D, Dychinco  B, Webb  VA, Davies  J. Antibiotic resistance in the ECOR collection: integrons and identification of a novel aad gene. Antimicrob Agents Chemother. 2000;44:1568–74. DOIPubMedGoogle Scholar
  16. Huang  X, Madan  A. CAP3: a DNA sequence assembly program. Genome Res. 1999;9:868–77. DOIPubMedGoogle Scholar
  17. Altschul  SF, Gish  W, Miller  W, Myers  EW, Lipman  DJ. Basic local alignment search tool. J Mol Biol. 1990;215:403–10.PubMedGoogle Scholar
  18. Thompson  JD, Higgins  DG, Gibson  TJ. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994;22:4673–80. DOIPubMedGoogle Scholar
  19. Ash  RJ. Antibiotic resistance of gram-negative bacteria in rivers, United States. Emerg Infect Dis. 2002;8:713–6.PubMedGoogle Scholar
  20. Goni-Urriza  M, Capdepuy  M, Arpin  C, Raymond  N, Caumette  P, Quentin  C, Impact of an urban effluent on antibiotic resistance of riverine Enterobacteriaceae and Aeromonas spp. Appl Environ Microbiol. 2000;66:125–32. DOIPubMedGoogle Scholar
  21. American Academy of Microbiology. Antimicrobial resistance: an ecological perspective. Washington: American Society for Microbiology; 1999. p. 1–14.
  22. Wegener  HC, Aarestrup  FM, Jensen  LB, Hammerum  AM, Bager  F. Use of antimicrobial growth promoters in food animals and Enterococcus faecium resistance to therapeutic antimicrobial drugs in Europe. Emerg Infect Dis. 1999;5:329–35. DOIPubMedGoogle Scholar
  23. Hall  RM, Collis  CM. Antibiotic resistance in gram-negative bacteria: the role of gene cassettes and integrons. Drug Resist Updat. 1998;1:109–19. DOIPubMedGoogle Scholar
  24. Bass  L, Liebert  CA, Lee  MD, Summers  AO, White  DG, Thayer  SG, Incidence and characterization of integrons, genetic elements mediating multiple-drug resistance, in avian Escherichia coli. Antimicrob Agents Chemother. 1999;43:2925–9.PubMedGoogle Scholar
  25. Cech  I, Essman  A. Water sanitation practices on the Texas-Mexico border: implications for physicians on both sides. South Med J. 1992;85:1053–64.PubMedGoogle Scholar
  26. McEwen  SA, Fedorka-Cray  PJ. Antimicrobial use and resistance in animals. Clin Infect Dis. 2002;34(Suppl 3):S93–106. DOIPubMedGoogle Scholar
  27. Schwarz  S, Chaslus-Dancla  E. Use of antimicrobials in veterinary medicine and mechanisms of resistance. Vet Res. 2001;32:201–25. DOIPubMedGoogle Scholar
  28. Texas Water Development Board, New Mexico Water Resources Research Institute. Transboundary aquifers of the El Paso/Ciudad Juarez/Las Cruces region. El Paso (TX): The Institute; 1997. p. 152.
  29. Simpson  JM, Santo Domingo  JW, Reasoner  DJ. Microbial source tracking: state of the science. Environ Sci Technol. 2002;36:5279–88. DOIPubMedGoogle Scholar
  30. Rosser  SJ, Young  HK. Identification and characterization of class 1 integrons in bacteria from an aquatic environment. J Antimicrob Chemother. 1999;44:11–8. DOIPubMedGoogle Scholar
  31. Sundstrom  L, Radstrom  P, Swedberg  G, Skold  O. Site-specific recombination promotes linkage between trimethoprim- and sulfonamide-resistance genes. Sequence characterization of dhfrV and sulI and a recombination active locus of Tn21. Mol Gen Genet. 1988;213:191–201. DOIPubMedGoogle Scholar
  32. Pillai  SD, Pepper  IL. Transposon Tn5 as an identifiable marker in Rhizobia: survival and genetic stability of Tn5 mutant bean Rhizobia under temperature stressed conditions in desert soils. Microb Ecol. 1990;21:21–33. DOIGoogle Scholar
  33. Sundstrom  L, Roy  PH, Skold  O. Site-specific insertion of three structural gene cassettes in transposon Tn7. J Bacteriol. 1991;173:3025–8.PubMedGoogle Scholar
  34. Hansson  K, Sundstrom  L, Pelletier  A, Roy  PH. IntI2 integron integrase in Tn7. J Bacteriol. 2002;184:1712–21. DOIPubMedGoogle Scholar
  35. Huovinen  P, Sundstrom  L, Swedberg  G, Skold  O. Trimethoprim and sulfonamide resistance. Antimicrob Agents Chemother. 1995;39:279–89.PubMedGoogle Scholar

Main Article

Page created: December 22, 2010
Page updated: December 22, 2010
Page reviewed: December 22, 2010
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external