Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link
Volume 13, Number 8—August 2007
Dispatch

Babesia sp. EU1 from Roe Deer and Transmission within Ixodes ricinus

Sarah Bonnet*Comments to Author , Maggy Jouglin*, Monique L’Hostis†, and Alain Chauvin†
Author affiliations: *Institut National de la Recherche Agronomique, Nantes, France; †Ecole Nationale Vétérinaire de Nantes, Nantes, France;

Main Article

Table 1

Nucleotide sequences of PCR primers used for amplification and sequencing of 18S rRNA genes of Babesia spp.*

Primer Specificity Sequence (5′→3′) Annealing temperature, °C Fragment size, bp Reference
BAB Babesia/Theileria spp. 60 359 (11)
GF2 GYYTTGTAATTGGAATGATGG
GR2 CCAAAGACTTTGATTTCTCTC
EU1 Babesia sp. EU1 63 362 (8)
Up GTTTCTGMCCCATCAGCTTGAC
Down AGACAAGAGTCAATAACTCGATAAC
CRYPTO Apicomplexa 65 1,727 (4)
F AACCTGGTTGATCCTGCCAGTAGTCAT
R GAATGATCCTTCCGCAGGTTCACCTAC

*For parasites from tick samples, no sequence could be obtained with primer set CRYPTO because such primers likely hybridize to the Ixodes ricinus 18S rRNA gene and preferentially amplified this gene, probably because of its relative abundance.

Main Article

References
  1. Kjemtrup  AM, Conrad  PA. Human babesiosis: an emerging tick-borne disease. Int J Parasitol. 2000;30:1323–37. DOIPubMedGoogle Scholar
  2. Gorenflot  A, Moubri  K, Precigout  E, Carcy  B, Schetters  TP. Human babesiosis. Ann Trop Med Parasitol. 1998;92:489–501. DOIPubMedGoogle Scholar
  3. Berry  A, Morassin  B, Kamar  N, Magnaval  JF. Clinical picture: human babesiosis. Lancet. 2001;357:341. DOIPubMedGoogle Scholar
  4. Herwaldt  BL, Caccio  S, Gherlinzoni  F, Aspock  H, Slemenda  SB, Piccaluga  P, Molecular characterization of a non-Babesia divergens organism causing zoonotic babesiosis in Europe. Emerg Infect Dis. 2003;9:942–8.PubMedGoogle Scholar
  5. Duh  D, Petrovec  M, Bidovec  A, Avsic-Zupanc  T. Cervids as Babesiae hosts, Slovenia. Emerg Infect Dis. 2005;11:1121–3.PubMedGoogle Scholar
  6. Duh  D, Petrovec  M, Avsic-Zupanc  T. Molecular characterization of human pathogen Babesia EU1 in Ixodes ricinus ticks from Slovenia. J Parasitol. 2005;91:463–5. DOIPubMedGoogle Scholar
  7. Casati  S, Sager  H, Gern  L, Piffaretti  JC. Presence of potentially pathogenic Babesia sp. for human in Ixodes ricinus in Switzerland. Ann Agric Environ Med. 2006;13:65–70.PubMedGoogle Scholar
  8. Hilpertshauser  H, Deplazes  P, Schnyder  M, Gern  L, Mathis  A. Babesia spp. identified by PCR in ticks collected from domestic and wild ruminants in southern Switzerland. Appl Environ Microbiol. 2006;72:6503–7. DOIPubMedGoogle Scholar
  9. Malandrin  L, L’Hostis  M, Chauvin  A. Isolation of Babesia divergens from carrier cattle blood using in vitro culture. Vet Res. 2004;35:131–9. DOIPubMedGoogle Scholar
  10. Chauvin  A, Valentin  A, Malandrin  L, L’Hostis  M. Sheep as a new experimental host for Babesia divergens. Vet Res. 2002;33:429–33. DOIPubMedGoogle Scholar
  11. Bonnet  S, Jouglin  M, Malandrin  L, Becker  C, Agoulon  A, L’Hostis  M, Transstadial and transovarial persistence of Babesia divergens DNA in Ixodes ricinus ticks fed on infected blood in a new skin-feeding technique. Parasitology. 2007;134:197–207. DOIPubMedGoogle Scholar
  12. Duh  D, Petrovec  M, Avsic-Zupanc  T. Diversity of Babesia infecting European sheep ticks (Ixodes ricinus). J Clin Microbiol. 2001;39:3395–7. DOIPubMedGoogle Scholar

Main Article

Page created: June 30, 2010
Page updated: June 30, 2010
Page reviewed: June 30, 2010
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external