Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link
Volume 16, Number 3—March 2010
Dispatch

Influenza A Pandemic (H1N1) 2009 Virus Infection in Domestic Cat

Brett A. SponsellerComments to Author , Erin Strait, Albert Jergens, Jessie Trujillo, Karen Harmon, Leo Koster, Melinda Jenkins-Moore, Mary Killian, Sabrina Swenson, Holly Bender, Ken Waller, Kristina Miles, Tracy Pearce, Kyoung-Jin Yoon, and Peter Nara
Author affiliations: Iowa State University, Ames, Iowa, USA (B. A. Sponseller, E. Strait, A. Jergens, J. Trujillo, K. Harmon, H. Bender, K. Waller, K. Miles, T. Pearce, K.-Y. Yoon, P. Nara); US Department of Agriculture National Veterinary Services Laboratories, Ames (L. Koster, M. Jenkins-Moore, M. Killian, S. Swenson)

Main Article

Table 2

Oligonucleotide sequences for primers and probes and dye labels used in confirmatory molecular testing for pandemic (H1N1) 2009 virus, National Veterinary Services Laboratories, Ames, Iowa, USA, 2009*

M+64 TCAGGCCCCCTCAAAGCCGA M probe, BHQ, FAM
Pandemic influenza N1 differentiation assay
N1 220F CAACACCAACTTTGCTGC N1 forward primer
N1 330R GGAACCGATTCTTACACTGTTGTC N1 reverse primer
N1 232 caGtcaGtGGttTccGtGaaattaGc N1 BHQ, FAM

*Primers and probes were obtained from Integrated DNA Technologies (Coralville, IA, USA) and Biosearch Technologies, Inc. (Novato, CA, USA), respectively. M, matrix; AI, avian influenza; N, neuraminidase.

Main Article

Page created: December 14, 2010
Page updated: December 14, 2010
Page reviewed: December 14, 2010
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external