Volume 16, Number 3—March 2010
Dispatch
Influenza A Pandemic (H1N1) 2009 Virus Infection in Domestic Cat
Table 2
Oligonucleotide sequences for primers and probes and dye labels used in confirmatory molecular testing for pandemic (H1N1) 2009 virus, National Veterinary Services Laboratories, Ames, Iowa, USA, 2009*
| M+64 | TCAGGCCCCCTCAAAGCCGA | M probe, BHQ, FAM |
|---|---|---|
| Pandemic influenza N1 differentiation assay | ||
| N1 220F | CAACACCAACTTTGCTGC | N1 forward primer |
| N1 330R | GGAACCGATTCTTACACTGTTGTC | N1 reverse primer |
| N1 232 | caGtcaGtGGttTccGtGaaattaGc | N1 BHQ, FAM |
*Primers and probes were obtained from Integrated DNA Technologies (Coralville, IA, USA) and Biosearch Technologies, Inc. (Novato, CA, USA), respectively. M, matrix; AI, avian influenza; N, neuraminidase.
Page created: December 14, 2010
Page updated: December 14, 2010
Page reviewed: December 14, 2010
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.