Volume 16, Number 4—April 2010
Research
Escherichia albertii in Wild and Domestic Birds
Table 2
Primer | Sequence, 5′ → 3′ | Position (GenBank accession no.) | Reference |
---|---|---|---|
Intimin γ F | CGTTGAAGTCGAGTACGCCA | 1867–1887 (AF081185) | (9) |
Intimin γ R | TTCTACACAAACCGCATAGA | 2782–2803 (AF081185) | (9) |
EaeA-F | CAAACCAAGGCCAGCATTAC | 1963–1982 (AF081185) | This study |
EaeA-R outer | CCCCAAGAGAGAGGGTTCTT | 2743–2763 (AF081185) | This study |
EaeA-R inner | ACTTGATACCCCAGACCTTCA | 2703–2725 (AF081185) | This study |
EscD-R1 | GTATCAACATCTCCCGCCA | 27918–27937 (AF022236) | (17) |
Intimin-R2 | CAGAATATTAAACAAGCGCAGTTG | 3103–3126 (FJ609833) | This study |
EaeA F06s | GTAACGGACTTTACGGCTGATA | 1803–1824 (FJ609833) | (10) |
Intimin B101 int R | TGACCATATTGCAACCA | 2460–2476 (FJ609833) | This study |
Intimin B156 int R | TGACCATATCGCAACCA | 2459–2475 (FJ609822) | This study |
Page created: December 23, 2010
Page updated: December 23, 2010
Page reviewed: December 23, 2010
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.