Volume 16, Number 6—June 2010
Letter
Laboratory Diagnosis of Lassa Fever, Liberia
Table
Laboratory results and primer sequences on 12 patients with Lassa fever, Liberia*†
Strain designation‡ | Deviations from sequence (5′ → 3′)‡ |
Original primers (6) | Modified primers | Cell culture | Log10 RNA copies/mL | Anti-LASV IgM titer‡ | Anti-LASV IgG titer‡ |
---|---|---|---|---|---|---|---|
TGCACAAAGAACAACAGTCATCATTATAT | |||||||
129/05 | ---T----A-----T-----C-------- | – | + | + | 3.20 | Neg | <10 |
UN133 | ---T----A-----T-----C-------- | – | + | + | 3.99 | Neg | <10 |
121/1580 | --T-----A-----------C--C----- | – | + | + | 4.14 | Neg | <10 |
127/05 | --------A-------------------- | + | + | + | 6.22 | Neg | <10 |
4094/05 | --------A-----------------C-- | + | + | + | 4.53 | Neg | <10 |
Lib3800 | --T-----------------C-------- | + | + | + | 4.90 | 160 | 5,120 |
Lib88 | --T-----------------C—-C----- | + | + | + | 7.49 | 40 | 20 |
Lib90 | --T-----------------C—-C----- | + | + | + | 5.17 | Neg | <10 |
295/06 | --T-----------------C—-C----- | + | + | + | 5.41 | 80 | 640 |
383/06 | --------------------C--C--C-- | + | + | + | 4.38 | 40 | <10 |
120/06 | --------A--------C--C-----C-- | + | + | + | 4.50 | Neg | <10 |
174/06 | -----------TG-T--C--C--C--C-- | + | + | + | 5.02 | 320 | 640 |
*LASV, Lassa fever virus; Ig, immunoglobulin.
†Primers sequences are compared to that published by Demby et al. (6) (reverse primer binding sites). Virus isolation was done on Vero cells in a BioSafety level 4 laboratory. Serologic testing for anti-LASV IgM and IgG was performed by using the indirect immunofluorescent assay.
‡From reference strain AY628203, position 3092–3064 = reverse primer binding site in (6); note that the forward primer is not analyzed because it is located in the conserved stem-loop structure of LASV small segment RNA.
References
- McCormick JB, Webb PA, Krebs JW, Johnson KM, Smith ES. A prospective study of the epidemiology and ecology of Lassa fever. J Infect Dis. 1987;155:437–44.PubMedGoogle Scholar
- Ter Meulen J, Koulemou K, Wittekindt T, Windisch K, Strigl S, Conde S, Detection of Lassa virus antinucleoprotein immunoglobulin G (IgG) and IgM antibodies by a simple recombinant immunoblot assay for field use. J Clin Microbiol. 1998;36:3143–8.PubMedGoogle Scholar
- Fair J, Jentes E, Inapogui A, Kourouma K, Goba A, Bah A, Lassa virus–infected rodents in refugee camps in Guinea: a looming threat to public health in a politically unstable region. Vector Borne Zoonotic Dis. 2007;7:167–71. DOIPubMedGoogle Scholar
- Khan SH, Goba A, Chu M, Roth C, Healing T, Marx A, New opportunities for field research on the pathogenesis and treatment of Lassa fever. Antiviral Res. 2008;78:103–15. DOIPubMedGoogle Scholar
- Drosten C, Kummerer BM, Schmitz H, Gunther S. Molecular diagnostics of viral hemorrhagic fevers. Antiviral Res. 2003;57:61–87. DOIPubMedGoogle Scholar
- Demby AH, Chamberlain J, Brown DW, Clegg CS. Early diagnosis of Lassa fever by reverse transcription–PCR. J Clin Microbiol. 1994;32:2898–903.PubMedGoogle Scholar
- Drosten C, Gottig S, Schilling S, Asper M, Panning M, Schmitz H, Rapid detection and quantification of RNA of Ebola and Marburg viruses, Lassa virus, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, dengue virus, and yellow fever virus by real-time reverse transcription–PCR. J Clin Microbiol. 2002;40:2323–30. DOIPubMedGoogle Scholar
- Trappier SG, Conaty AL, Farrar BB, Auperin DD, McCormick JB, Fisher-Hoch SP. Evaluation of the polymerase chain reaction for diagnosis of Lassa virus infection. Am J Trop Med Hyg. 1993;49:214–21.PubMedGoogle Scholar
- Bowen MD, Rollin PE, Ksiazek TG, Hustad HL, Bausch DG, Demby AH, Genetic diversity among Lassa virus strains. J Virol. 2000;74:6992–7004. DOIPubMedGoogle Scholar
- Bausch DG, Rollin PE, Demby AH, Coulibaly M, Kanu J, Conteh AS, Diagnosis and clinical virology of Lassa fever as evaluated by enzyme-linked immunosorbent assay, indirect fluorescent-antibody test, and virus isolation. J Clin Microbiol. 2000;38:2670–7.PubMedGoogle Scholar
Page created: February 11, 2011
Page updated: February 11, 2011
Page reviewed: February 11, 2011
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.