Skip directly to page options Skip directly to A-Z link
Volume 16, Number 6—June 2010
Letter

Laboratory Diagnosis of Lassa Fever, Liberia

Marcus Panning, Petra Emmerich, Stephan Ölschläger, Sergiusz Bojenko, Lamine Koivogui, Arthur Marx, Peter Clement Lugala, Stephan Günther, Daniel G. Bausch, and Sung Sup ParkComments to Author 
Author affiliations: Bernhard Nocht Institute for Tropical Medicine, Hamburg, Germany (M. Panning, P. Emmerich, S. Ölschläger, S. Günther, C. Drosten); United Nations Mission in Sierra Leone, Freetown, Sierra Leone (S. Bojenko); Program on Hemorrhagic Fevers, Conakry, Guinea (L. Koivogui); World Health Organization, Geneva, Switzerland (A. Marx); World Health Organization, Monrovia, Liberia (P.C. Lugala); Tulane University Health Sciences Center, New Orleans, Louisiana, USA (D.G. Bausch)

Main Article

Table

Laboratory results and primer sequences on 12 patients with Lassa fever, Liberia*†

Strain
designation‡ Deviations from sequence (5′ → 3′)‡
Original primers (6) Modified primers Cell culture Log10 RNA copies/mL Anti-LASV IgM titer‡ Anti-LASV IgG titer‡
TGCACAAAGAACAACAGTCATCATTATAT
129/05 ---T----A-----T-----C-------- + + 3.20 Neg <10
UN133 ---T----A-----T-----C-------- + + 3.99 Neg <10
121/1580 --T-----A-----------C--C----- + + 4.14 Neg <10
127/05 --------A-------------------- + + + 6.22 Neg <10
4094/05 --------A-----------------C-- + + + 4.53 Neg <10
Lib3800 --T-----------------C-------- + + + 4.90 160 5,120
Lib88 --T-----------------C—-C----- + + + 7.49 40 20
Lib90 --T-----------------C—-C----- + + + 5.17 Neg <10
295/06 --T-----------------C—-C----- + + + 5.41 80 640
383/06 --------------------C--C--C-- + + + 4.38 40 <10
120/06 --------A--------C--C-----C-- + + + 4.50 Neg <10
174/06 -----------TG-T--C--C--C--C-- + + + 5.02 320 640

*LASV, Lassa fever virus; Ig, immunoglobulin.
†Primers sequences are compared to that published by Demby et al. (6) (reverse primer binding sites). Virus isolation was done on Vero cells in a BioSafety level 4 laboratory. Serologic testing for anti-LASV IgM and IgG was performed by using the indirect immunofluorescent assay.
‡From reference strain AY628203, position 3092–3064 = reverse primer binding site in (6); note that the forward primer is not analyzed because it is located in the conserved stem-loop structure of LASV small segment RNA.

Main Article

References
  1. McCormick  JB, Webb  PA, Krebs  JW, Johnson  KM, Smith  ES. A prospective study of the epidemiology and ecology of Lassa fever. J Infect Dis. 1987;155:43744.PubMedGoogle Scholar
  2. Ter Meulen  J, Koulemou  K, Wittekindt  T, Windisch  K, Strigl  S, Conde  S, Detection of Lassa virus antinucleoprotein immunoglobulin G (IgG) and IgM antibodies by a simple recombinant immunoblot assay for field use. J Clin Microbiol. 1998;36:31438.PubMedGoogle Scholar
  3. Fair  J, Jentes  E, Inapogui  A, Kourouma  K, Goba  A, Bah  A, Lassa virus–infected rodents in refugee camps in Guinea: a looming threat to public health in a politically unstable region. Vector Borne Zoonotic Dis. 2007;7:16771. DOIPubMedGoogle Scholar
  4. Khan  SH, Goba  A, Chu  M, Roth  C, Healing  T, Marx  A, New opportunities for field research on the pathogenesis and treatment of Lassa fever. Antiviral Res. 2008;78:10315. DOIPubMedGoogle Scholar
  5. Drosten  C, Kummerer  BM, Schmitz  H, Gunther  S. Molecular diagnostics of viral hemorrhagic fevers. Antiviral Res. 2003;57:6187. DOIPubMedGoogle Scholar
  6. Demby  AH, Chamberlain  J, Brown  DW, Clegg  CS. Early diagnosis of Lassa fever by reverse transcription–PCR. J Clin Microbiol. 1994;32:2898903.PubMedGoogle Scholar
  7. Drosten  C, Gottig  S, Schilling  S, Asper  M, Panning  M, Schmitz  H, Rapid detection and quantification of RNA of Ebola and Marburg viruses, Lassa virus, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, dengue virus, and yellow fever virus by real-time reverse transcription–PCR. J Clin Microbiol. 2002;40:232330. DOIPubMedGoogle Scholar
  8. Trappier  SG, Conaty  AL, Farrar  BB, Auperin  DD, McCormick  JB, Fisher-Hoch  SP. Evaluation of the polymerase chain reaction for diagnosis of Lassa virus infection. Am J Trop Med Hyg. 1993;49:21421.PubMedGoogle Scholar
  9. Bowen  MD, Rollin  PE, Ksiazek  TG, Hustad  HL, Bausch  DG, Demby  AH, Genetic diversity among Lassa virus strains. J Virol. 2000;74:69927004. DOIPubMedGoogle Scholar
  10. Bausch  DG, Rollin  PE, Demby  AH, Coulibaly  M, Kanu  J, Conteh  AS, Diagnosis and clinical virology of Lassa fever as evaluated by enzyme-linked immunosorbent assay, indirect fluorescent-antibody test, and virus isolation. J Clin Microbiol. 2000;38:26707.PubMedGoogle Scholar

Main Article

Page created: February 11, 2011
Page updated: February 11, 2011
Page reviewed: February 11, 2011
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external