Collection of Fecal Samples

A total of 278 rectal swab samples from house cats of different age, sex, and breed were taken between July and November 2003. All house cats came from different owners. The animals came from all over the Dutch-speaking part of Belgium, i.e., north of Brussels. Rectal swab specimens were also taken from 58 cats that were submitted for autopsy to the Faculty of Veterinary Medicine, Ghent University. The latter died or were euthanized because of incurable disease (Table 1). All cats came from different owners, except three cats that had feline immunodeficiency virus (FIV), which came from one owner. Finally, rectal samples of 35 kittens (all <4 months of age) were taken at a facility where the animals were group-housed, waiting to be adopted. These animals came from 16 different owners.

Bacteriologic Analysis

Bacteriologic analysis was performed by enrichment of the rectal swabs. The samples were first pre-enriched in buffered peptone water (BPW) (Oxoid, Basingstoke, Hampshire, UK) overnight at 37°C, after which 1 mL of this suspension was added to 9 mL of tetrathionate brilliant green broth (Oxoid) (enrichment). After incubation overnight at 37°C, a drop of this suspension was spread on brilliant green agar (BGA) (Oxoid). Both the serotype and phage type of positive isolates were determined.

Antimicrobial Susceptibility Testing

Resistance to antimicrobial agents was tested by using the disk diffusion assay on Mueller-Hinton agar with commercial antimicrobial susceptibility disks (Oxoid) according to the international standards of the National Council for Clinical Laboratory Standards (NCCLS) (8). The following antimicrobial agents were tested: ampicillin (A 10 μg), chloramphenicol (C 30 μg), streptomycin (S 10 μg), sulfonamide (Su 300 μg), tetracycline (T 30 μg), ciprofloxacin (Cip 5 μg), kanamycin (K 30 μg), gentamicin (Gn 10 μg), sulfamethoxazole-trimethoprim (Sxt 25 μg), cefotaxime (Cxt 30 μg), nalidixic acid (Na 30 μg), and amoxicillin-clavulanic acid (Amc 30 μg). Salmonella enterica serovar Typhimurium 8420 (resistance type ACSSuT), 6237 (sensitive), 3520 (resistance type T), 2200 (resistance type ASSuT), and 5833 (sensitive). Isolates from human patients in Belgium were used as control strains in antimicrobial susceptibility testing.

Polymerase Chain Reaction (PCR)

For PCR, a loop of bacterial culture was resuspended in 50 μL of water, and DNA was released from bacterial cells by boiling for 20 min. After the mixture was spun for 1 min in a microfuge at 14,000 x g, 2 μL of the supernatant was taken as a template DNA for PCR. PCR was carried out in 20-μL volumes by using PCR Master Mix from Qiagen (Hilden, Germany), according to the manufacturer’s instructions. All the resistant strains were tested for the presence of the genes typical for particular resistance. The genes determined and primers used are listed in Table 2. Cycling consisted of 50-s incubations at 92°C, 55°C, and 72ºC, which were repeated 25 times. After PCR, amplification products were detected by electrophoresis in 2% agarose gel, stained with ethidium bromide, and visualized under UV light. Antimicrobial drug−sensitive strain S. Typhimurium F98 was used as a negative control in all the amplifications. S. Typhimurium strains 8420, 6237, 3520, 2200, and 5833 were used as positive controls.

All Salmonella strains were tested for the presence of the SopB gene. The primers were GATAGGAAAGATTGAGCACCTCTG and TACAGAGCTTCTATCACTCAGCTTC, and the PCR cycle consisted of 30 cycles of (30 s 95°C, 1 min 58°C, 1 min 72°C).

Pulsed-Field Gel Electrophoresis (PFGE)

The bacteria were grown while being shaken overnight at 37°C in Luria-Bertani broth (LB). The XbaI PFGE patterns were determined for all 21 S. Typhimurium strains by using previously described PFGE methods (16,17) with some slight modifications. The patterns were grouped in a dendrogram with GelCompar II software (Applied Maths, St.-Martens-Latem, Belgium) by using the Dice coefficient and the unweighted pair group method with an arithmetic averages clustering algorithm.

Invasion of the Human intestinal Epithelial Cell Line T84

The capacity of all cat Salmonella isolates and the human S. Typhimurium isolates 8420, 6237, 3520, 2200, and 5833 to invade human intestinal epithelial cells was determined. Cells of the human colon carcinoma cell line T84 were seeded in 96-well cell culture plates (Greiner, Frickenhausen, Germany) at a density of 5.10⁵ cells/mL culture medium (DMEM + 10% fetal calf serum + 2% L-glutamine, without antimicrobial drugs) and grown for 24 h. Bacteria were grown for 20 h in LB-medium, after which the suspension was diluted 1:50 in fresh LB-medium. After 4 h of incubation at 37°C, suspensions were centrifuged and resuspended in DMEM with 10% fetal calf serum (FCS). The number of colony-forming units (CFU)/mL was determined by plating 10-fold dilutions on BGA. The suspensions were stored overnight at 4°C. The next day, 10⁶ CFU in 200 μL were added to the T84 cell cultures, which were then centrifuged for 10 min at 1,500 rpm to make close contact between the bacteria and the colon cells. The plates were incubated for 1 h at 37°C and 5% CO₂. The cells were then rinsed three times with Hanks’ Balanced Salt Solution (HBSS, Life Technologies, Paisley, Scotland). Cell culture medium with gentamicin (50 μg/mL) was added, and plates were incubated for 1 h at 37°C and 5% CO₂. Hereafter, the cells were rinsed three times with PBS and analyzed with 1% Triton X-100 (Sigma, St. Louis, MO) in distilled water. From this lysate, 10-fold dilution series were made. From each dilution, 6 x 20 μL was added to BGA, to determine the number of CFU Salmonella per mL. The assays were performed in triplicate. The percentage of intracellular bacteria, relative to the number of Salmonella bacteria, initially incubated with the cells, was calculated. The previously mentioned human isolates of Salmonella Typhimurium were used for comparison between the cat isolates and human isolates. Statistical analysis was performed by analysis of variance methods using the SPSS 11.0 software.

Characterization of Salmonella Isolates from Cats

Of 278 healthy house cats, 1 Salmonella strain was isolated, an S. Enteritidis phage type 21 strain, sensitive to all tested antimicrobial drugs. Five strains were isolated from cats that died from or were euthanized because of incurable disease. Feline AIDS (caused by feline immunodeficiency virus [FIV]) was diagnosed in three cats, one died due to feline panleukopenia parvovirus infection, and one was poisoned.

Figure 1

Figure 1. Dendrogram obtained by unweighted pair group method using arithmetic averages clustering of the pulsed-field gel electrophoresis–XbaI patterns of serovar Typhimurium strains isolated from cats on the basis of the Dice coefficient....

Three isolates were identified as being ampicillin-resistant S. Typhimurium phage type 193, harboring the bla_TEM gene. They had the same pulsed-field gel electrophoresis (XbaI) pattern, indicating that the isolates were of clonal origin (Figure 1). The three cats came from the same owner. One isolate was an antimicrobial drug–sensitive Salmonella Bovismorbificans strain. One isolate was Salmonella 4:i:-, which was resistant to ampicillin, chloramphenicol, sulfonamides, tetracycline and sulfamethoxazole-trimethoprim (ACSuTSxt), harboring the bla_TEM, cat, sul2, tet(A), and dfrA1 antimicrobial drug–resistance genes. Eighteen strains were isolated from the group-housed cats. All of these were S. Typhimurium phage type 120/ad. Fourteen of these strains showed acquired resistance to ampicillin, chloramphenicol and tetracycline and harbored the bla_TEM, cat, and tet(A) antimicrobial drug−resistance genes, while four isolates were resistant to chloramphenicol only and only harbored the cat gene. Pulsed-field gel electrophoresis showed that the isolates from the group-housed cats were of the same XbaI PFGE type, and that three subtypes within this type were present, indicating a clonal origin (Figure 1). One subtype contained the 14 strains that were resistant to the three mentioned antimicrobial drugs. All Salmonella strains harbored the SopB gene.

Invasion of the Human Intestinal Epithelial Cell Line T84

Figure 2

Figure 2. Invasion of Salmonella strains in the human intestinal epithelial cell line T84. The y-axis shows the percentages of intracellular bacteria 2 hours postinfection, relative to the initial number of bacteria, incubated...

All isolates invaded T84 cells, with the cat isolates of S. Typhimurium PT193 (strains 1147, 1145, and 55, which belong to the same clone) and the human isolate S. Typhimurium strain 2200, the most invasive, yielding a percentage of invasion of 8% to 10%. The multidrug−resistant cat isolate Salmonella 4:i:- (strain 11) was the least invasive strain, having an invasion percentage of about 0.5%. Invasion percentages of the different isolates are shown in Figure 2. Of the strains of the same PFGE type, only one was shown in Figure 2, since no significant differences were detected between the invasion percentages of these strains. Statistically significant differences are shown in the figure.