Volume 11, Number 1—January 2005
Research
Mycobacterium haemophilum and Lymphadenitis in Children
Table 1
Sequences of oligonucleotides used in this study
Primer/probe sequence (5′–3′) target sequence | ||
---|---|---|
ITS forward primer real-time PCR | GGGGTGTGGTGTTTGAG | Partial ITS |
ITS reverse primer real-time PCR | CTCCCACGTCCTTCATC | Partial ITS |
Forward primer Ec16S.1390p* | TTGTACACACCGCCCGTCA | Total ITS |
Reverse primer Mb23S.44n* | TCTCGATGCCAAGGCATCCACC | Total ITS |
16S forward primer P1† | TAACACATGCAAGTCGAACG | 16S |
16S reverse primer P4† | TCGTTGCGGGACTTAACCCAAC | 16S |
Mycobacterium genus–specific TaqMan probe | Fam-GGATAGTGGTTGCGAGCATC-Tamra | ITS |
M. haemophilum–specific MGB-probe | VIC–ACGCCACCATTACT-MGB | ITS |
*Primers published in (19).
†Primers published in (23).
References
- American Thoracic Society. Diagnosis and treatment of disease caused by nontuberculous mycobacteria. Am J Respir Crit Care Med. 1997;156(Suppl):S1–25.PubMedGoogle Scholar
- Dawson DJ, Blacklock ZM, Kane DW. Mycobacterium haemophilum causing lymphadenitis in an otherwise healthy child. Med J Aust. 1981;2:289–90.PubMedGoogle Scholar
- Thibert L, Lebel F, Martineau B. Two cases of Mycobacterium haemophilum infection in Canada. J Clin Microbiol. 1990;28:621–3.PubMedGoogle Scholar
- Armstrong KL, James RW, Dawson DJ, Francis PW, Masters B. Mycobacterium haemophilum causing perihilar or cervical lymphadenitis in healthy children. J Pediatr. 1992;121:202–5. DOIPubMedGoogle Scholar
- Haimi-Cohen Y, Zeharia A, Mimouni M, Soukhman M, Amir J. Skin indurations in response to tuberculin testing in patients with nontuberculous mycobacterial lymphadenitis. Clin Infect Dis. 2001;33:1786–8. DOIPubMedGoogle Scholar
- Saubolle MA, Kiehn TE, White MH, Rudinsky MF, Armstrong D. Mycobacterium haemophilum: microbiology and expanding clinical and geographic spectra of disease in humans. Clin Microbiol Rev. 1996;9:435–47.PubMedGoogle Scholar
- van de Griendt EJ, Rietra PJ, van Andel RN. Mycobacterium haemophilum as the cause of lymphadenitis in the neck in an otherwise healthy boy. Ned Tijdschr Geneeskd. 2003;147:1367–9.PubMedGoogle Scholar
- Bruijnesteijn van Coppenraet ES, Lindeboom JA, Prins JM, Peeters MF, Claas ECJ, Kuijper EJ. Real-time PCR assay using fine-needle aspirates and tissue biopsy specimens for rapid diagnosis of mycobacterial lymphadenitis in children. J Clin Microbiol. 2004;42:2644–50. DOIPubMedGoogle Scholar
- Samra Z, Kaufman L, Bechor J, Bahar J. Comparative study of three culture systems for optimal recovery of mycobacteria from different clinical specimens. Eur J Clin Microbiol Infect Dis. 2000;19:750–4. DOIPubMedGoogle Scholar
- Sampaio JL, Alves VA, Leao SC, De Magalhaes VD, Martino MD, Mendes CM, Mycobacterium haemophilum: emerging or underdiagnosed in Brazil? Emerg Infect Dis. 2002;8:1359–60.PubMedGoogle Scholar
- Shah MK, Sebti A, Kiehn TE, Massarella SA, Sepkowitz KA. Mycobacterium haemophilum in immunocompromised patients. Clin Infect Dis. 2001;33:330–7. DOIPubMedGoogle Scholar
- Dobos KM, Quinn FD, Ashford DA, Horsburgh CR, King CH. Emergence of a unique group of necrotizing mycobacterial diseases. Emerg Infect Dis. 1999;5:367–78. DOIPubMedGoogle Scholar
- von Reyn CF, William DE, Horsburgh CR Jr, Jaege AS, Mars BJ, Haslov K, Dual skin testing with Mycobacterium avium sensitin and purified protein derivative to discriminate pulmonary disease due to M. avium complex from pulmonary disease due to Mycobacterium tuberculosis. J Infect Dis. 1998;177:730–6. DOIPubMedGoogle Scholar
- Hansen KN, Heltberg I, Hjelt K. Sensitivity to tuberculin and sensitins from atypical mycobacteria (M. chelonae subsp. abscessus, M. avium, M. intracellulare, M. scrofulaceum) in 100 Danish school children. Dan Med Bull. 1989;36:399–401.PubMedGoogle Scholar
- Kubica GP, Dye WE, Cohn ML, Middlebrook G. Sputum digestion and decontamination with N-acetyl-L-cysteine-sodium hydroxide for culture of mycobacteria. Am Rev Respir Dis. 1963;87:775–9.PubMedGoogle Scholar
- Tortoli E, Mariottini A, Mazzarelli G. Evaluation of INNO-LiPA MYCOBACTERIA v2: improved reversehybridization multiple DNA probe assay for mycobacterial identification. J Clin Microbiol. 2003;41:4418–20. DOIPubMedGoogle Scholar
- Bergmans AM, Groothedde JW, Schellekens JF, van Embden JD, Ossewaarde JM, Schouls LM. Etiology of cat scratch disease: comparison of polymerase chain reaction detection of Bartonella (formerly Rochalimaea) and Afipia felis DNA with serology and skin tests. J Infect Dis. 1995;171:916–23. DOIPubMedGoogle Scholar
- Boom R, Sol CJ, Salimans MM, Jansen CL, Wertheim-van Dillen PM, van der Noordaa J. Rapid and simple method for purification of nucleic acids. J Clin Microbiol. 1990;28:495–503.PubMedGoogle Scholar
- Frothingham R, Wilson KH. Sequence-based differentiation of strains in the Mycobacterium avium complex. J Bacteriol. 1993;175:2818–25.PubMedGoogle Scholar
- Kuijper EJ, Stevens S, Imamura T, De Wever B, Claas EC. Genotypic identification of erythromycin-resistant Campylobacter isolates as Helicobacter species and analysis of resistance mechanism. J Clin Microbiol. 2003;41:3732–6. DOIPubMedGoogle Scholar
- Roth A, Fischer M, Hamid ME, Michalke S, Ludwig W, Mauch H. Differentiation of phylogenetically related slowly growing mycobacteria based on 16S-23S rRNA gene internal transcribed spacer sequences. J Clin Microbiol. 1998;36:139–47.PubMedGoogle Scholar
- Rozen S, Skaletsky HJ. Primer3 on the WWW for general users and for biologist programmers. In: Krawetz S, Misener S, editors. Bioinformatics methods and protocols: methods in molecular biology. Totowa (NJ): Humana Press; 2000. p. 365–86.
- Kutyavin IV, Afonina IA, Mills A, Gorn VV, Lukhtanov EA, Belousov ES, 3'-minor groove binder-DNA probes increase sequence specificity at PCR extension temperatures. Nucleic Acids Res. 2000;28:655–61. DOIPubMedGoogle Scholar
- Wolinsky E. Mycobacterial lymphadenitis in children: a prospective study of 105 nontuberculous cases with long-term follow-up. Clin Infect Dis. 1995;20:954–63. DOIPubMedGoogle Scholar
- Smith S, Taylor GD, Fanning EA. Chronic cutaneous Mycobacterium haemophilum infection acquired from coral injury. Clin Infect Dis. 2003;37:e100–1. DOIPubMedGoogle Scholar
- Falkinham JO III, Norton CD, LeChevallier MW. Factors influencing numbers of Mycobacterium avium, Mycobacterium intracellulare, and other mycobacteria in drinking water distribution systems. Appl Environ Microbiol. 2001;67:1225–31. DOIPubMedGoogle Scholar
- Pai HH, Chen WC, Peng CF. Isolation of non-tuberculous mycobacteria from hospital cockroaches (Periplaneta americana). J Hosp Infect. 2003;53:224–8. DOIPubMedGoogle Scholar
- Chang CT, Wang LY, Liao CY, Huang SP. Identification of nontuberculous mycobacteria existing in tap water by PCR-restriction fragment length polymorphism. Appl Environ Microbiol. 2002;68:3159–61. DOIPubMedGoogle Scholar
- Covert TC, Rodgers MR, Reyes AL, Stelma GN Jr. Occurrence of nontuberculous mycobacteria in environmental samples. Appl Environ Microbiol. 1999;65:2492–6.PubMedGoogle Scholar
- Carson LA, Bland LA, Cusick LB, Favero MS, Bolan GA, Reingold AL, Prevalence of nontuberculous mycobacteria in water supplies of hemodialysis centers. Appl Environ Microbiol. 1988;54:3122–5.PubMedGoogle Scholar
- Vadney FS, Hawkins JE. Evaluation of a simple method for growing Mycobacterium haemophilum. J Clin Microbiol. 1985;22:884–5.PubMedGoogle Scholar
- Murray PR. Manual of clinical microbiology, 8th ed. Washington: ASM Press; 2003.
- Dawson DJ, Jennis F. Mycobacteria with a growth requirement for ferric ammonium citrate, identified as Mycobacterium haemophilum. J Clin Microbiol. 1980;11:190–2.PubMedGoogle Scholar
- McBride JA, McBride M, Wolf JE. Evaluation of commercial blood-containing media for cultivation of Mycobacterium haemophilum. Am J Clin Pathol. 1992;98:282–6.PubMedGoogle Scholar
- Kvaerner KJ, Kvestad E, Orth M. Surgery required to verify atypical mycobacterial infections. Int J Pedriatr. Otorhinolaryngology. 2001;61:121–8.
- Rahal A, Abela A, Arcand PH, Quintal MC, Lebl MH, Tapier BF. Nontuberculous mycobacterial adenitis of the head and neck in children. Laryngoscope. 2001;111:1791–6. DOIPubMedGoogle Scholar
- Berger C, Pfyffer GE, Nadal D. Treatment of nontuberculous mycobacterial lymphadenitis with clarithromycin plus rifabutin. J Pediatr. 1996;128:383–6. DOIPubMedGoogle Scholar
- Lindeboom JA, de Lange J, van den Akker HP. Clarithromycin as a single-modality treatment in mycobacterial avium-intracellulare infections. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 1999;87:50–4. DOIPubMedGoogle Scholar
Page created: April 14, 2011
Page updated: April 14, 2011
Page reviewed: April 14, 2011
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.