Volume 12, Number 5—May 2006
Dispatch
Heterogeneity among Mycobacterium ulcerans Isolates from Africa
Table 2
Primer sequence and location in Mycobacterium ulcerans and amplicon length at loci 1, 6, 9, and 33, resulting from a polymorphism in tandem repeat copy numbers
Locus | Primer sequence |
Amplicon length |
|||||
---|---|---|---|---|---|---|---|
Forward primer (5´–3´) | Reverse primer (5´–3´) | Location | 1 copy | 2 copies | 3 copies | 4 copies | |
1 | GCTGGTTCATGCGTGGAAG | GCCCTCGGGAATGTGGTT | mu0115C04F | 380 | 433 | 486 | 539 |
6 | GACCGTCATGTCGTTCGATCCTAGT | GACATCGAAGAGGTGTGCCGTCT | mu0019B07G | 500 | 556 | – | – |
9 | GCCGAAGCCTTGTTGGACG | GGTTTCCCGCAGCATCTCG | mu0113D07F | 435 | 488 | – | – |
33 | CAAGACTCCCACCGACAGGC | CGGATCGGCACGGTTCA | mu0043E11R | 720 | 778 | 836 | – |
Page created: January 12, 2012
Page updated: January 12, 2012
Page reviewed: January 12, 2012
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.