Volume 12, Number 9—September 2006
Dispatch
Eighth Major Clade for Hepatitis Delta Virus
Table 1
Four overlapping regions amplified by reverse transcription–PCR for full-length genome sequence determination
Region* | Primer name† | Primer position | Nucleotide sequence of the primers (5´–3´) |
---|---|---|---|
R0 (889–1289) | 889s | 889–911 | CATGCCGACCCGAAGAGGAAAG |
1289as | 1289–1265 | GAAGGAAAGGCCCTCGAGAACAAGA | |
R´1 (305–1161) | 305s | 305–328 | CTCCAGAGGACCCCTTCAGCGAAC |
1161as | 1161–1138 | CCCGCGGGTTGGGGATGTGAACCC | |
R´2 (962–331) | 962s | 962–984 | GTACACTCGAGGAGTGGAAGGCG |
331as | 331–311 | TCTGTTCGCTGAAGGGGTCCT | |
R´3 (120–619) | 120s | 120–140 | GTCCCAAGAGGGCGAGGGGAG |
620as | 619–600 | TCCTGGAGCCGGCAGTCCGG |
*Name of the amplified region and position on the genome (according to Wang et al. [10]).
†s, forward primer; as, reverse primer.
References
- Radjef N, Gordien E, Ivaniushina V, Gault E, Anais P, Drugan T, Molecular phylogenetic analyses indicate a wide and ancient radiation of African hepatitis delta virus, suggesting a deltavirus genus of at least seven major clades. J Virol. 2004;78:2537–44. DOIPubMedGoogle Scholar
- Casey JL. RNA editing in hepatitis delta virus genotype III requires a branched double-hairpin RNA structure. J Virol. 2002;76:7385–97. DOIPubMedGoogle Scholar
- Imazeki F, Omata M, Ohto M. Heterogeneity and evolution rates of delta virus RNA sequences. J Virol. 1990;64:5594–9.PubMedGoogle Scholar
- Wu JC, Chen CM, Sheen IJ, Lee SD, Tzeng HM, Choo KB. Evidence of transmission of hepatitis D virus to spouses from sequence analysis of the viral genome. Hepatology. 1995;22:1656–60.PubMedGoogle Scholar
- Ivaniushina V, Radjef N, Alexeeva M, Gault E, Semenov S, Salhi M, Hepatitis delta virus genotypes I and II cocirculate in an endemic area of Yakutia, Russia. J Gen Virol. 2001;82:2709–18.PubMedGoogle Scholar
- Wu JC, Chiang TY, Sheen IJ. Characterization and phylogenetic analysis of a novel hepatitis D virus strain discovered by restriction fragment length polymorphism analysis. J Gen Virol. 1998;79:1105–13.PubMedGoogle Scholar
- Sakugawa H, Nakasone H, Nakayoshi T, Kawakami Y, Miyazato S, Kinjo F, Hepatitis delta virus genotype IIb predominates in an endemic area, Okinawa, Japan. J Med Virol. 1999;58:366–72. DOIPubMedGoogle Scholar
- Watanabe H, Nagayama K, Enomoto N, Chinzei R, Yamashiro T, Izumi N, Chronic hepatitis delta virus infection with genotype IIb variant is correlated with progressive liver disease. J Gen Virol. 2003;84:3275–89. DOIPubMedGoogle Scholar
- Casey JL, Brown TL, Colan EJ, Wignall FS, Gerin JL. A genotype of hepatitis D virus that occurs in northern South America. Proc Natl Acad Sci U S A. 1993;90:9016–20. DOIPubMedGoogle Scholar
- Huelsenbeck JP, Ronquist FR. MRBAYES: Bayesian inference of phylogeny. Biochemistry. 2006. In press.
- Casey JL, Gerin JL. Genotype-specific complementation of hepatitis delta virus RNA replication by hepatitis delta antigen. J Virol. 1998;72:2806–14.PubMedGoogle Scholar
- Simmonds P, Bukh J, Combet C, Deleage G, Enomoto N, Feinstone S, Consensus proposals for a unified system of nomenclature of hepatitis C virus genotypes. Hepatology. 2005;42:962–73. DOIPubMedGoogle Scholar
- Le Gal F, Gordien E, Affolabi D, Hanslik T, Alloui C, Deny P, Quantification of hepatitis delta virus RNA in serum by consensus real-time PCR indicates different patterns of virological response to interferon therapy in chronically infected patients. J Clin Microbiol. 2005;43:2363–9. DOIPubMedGoogle Scholar
- Modahl LE, Lai MM. Hepatitis delta virus: the molecular basis of laboratory diagnosis. Crit Rev Clin Lab Sci. 2000;37:45–92. DOIPubMedGoogle Scholar
- Niro GA, Rosina F, Rizzetto M. Treatment of hepatitis D. J Viral Hepat. 2005;12:2–9. DOIPubMedGoogle Scholar
- Martinot-Peignoux M, Marcellin P, Pouteau M, Castelnau C, Boyer N, Poliquin M, Pretreatment serum hepatitis C virus RNA levels and hepatitis C virus genotype are the main and independent prognostic factors of sustained response to interferon alfa therapy in chronic hepatitis C. Hepatology. 1995;22:1050–6. DOIPubMedGoogle Scholar
1These authors contributed equally to this work.
Page created: November 17, 2011
Page updated: November 17, 2011
Page reviewed: November 17, 2011
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.