Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link

Volume 12, Number 9—September 2006

Dispatch

Eighth Major Clade for Hepatitis Delta Virus

Frédéric Le Gal*1, Elyanne Gault*1, Marie-Pierre Ripault†, Jeanne Serpaggi‡, Jean-Claude Trinchet§, Emmanuel Gordien*, and Paul Dény*Comments to Author 
Author affiliations: *Hôpital Avicenne and EA3406, Université Paris 13, Bobigny, France; †Hôpital Saint-Louis, Assistance Publique - Hôpitaux de Paris, Paris, France; ‡Hôpital Necker, Assistance Publique - Hôpitaux de Paris, Paris, France; §Hôpital Jean Verdier, Assistance Publique - Hôpitaux de Paris, Bondy, France

Main Article

Table 1

Four overlapping regions amplified by reverse transcription–PCR for full-length genome sequence determination

Region* Primer name† Primer position Nucleotide sequence of the primers (5´–3´)
R0
(889–1289) 889s 889–911 CATGCCGACCCGAAGAGGAAAG
1289as 1289–1265 GAAGGAAAGGCCCTCGAGAACAAGA
R´1
(305–1161) 305s 305–328 CTCCAGAGGACCCCTTCAGCGAAC
1161as 1161–1138 CCCGCGGGTTGGGGATGTGAACCC
R´2
(962–331) 962s 962–984 GTACACTCGAGGAGTGGAAGGCG
331as 331–311 TCTGTTCGCTGAAGGGGTCCT
R´3
(120–619) 120s 120–140 GTCCCAAGAGGGCGAGGGGAG
620as 619–600 TCCTGGAGCCGGCAGTCCGG

*Name of the amplified region and position on the genome (according to Wang et al. [10]).
†s, forward primer; as, reverse primer.

Main Article

References
  1. Radjef  N, Gordien  E, Ivaniushina  V, Gault  E, Anais  P, Drugan  T, Molecular phylogenetic analyses indicate a wide and ancient radiation of African hepatitis delta virus, suggesting a deltavirus genus of at least seven major clades. J Virol. 2004;78:2537–44. DOIPubMedGoogle Scholar
  2. Casey  JL. RNA editing in hepatitis delta virus genotype III requires a branched double-hairpin RNA structure. J Virol. 2002;76:7385–97. DOIPubMedGoogle Scholar
  3. Imazeki  F, Omata  M, Ohto  M. Heterogeneity and evolution rates of delta virus RNA sequences. J Virol. 1990;64:5594–9.PubMedGoogle Scholar
  4. Wu  JC, Chen  CM, Sheen  IJ, Lee  SD, Tzeng  HM, Choo  KB. Evidence of transmission of hepatitis D virus to spouses from sequence analysis of the viral genome. Hepatology. 1995;22:1656–60.PubMedGoogle Scholar
  5. Ivaniushina  V, Radjef  N, Alexeeva  M, Gault  E, Semenov  S, Salhi  M, Hepatitis delta virus genotypes I and II cocirculate in an endemic area of Yakutia, Russia. J Gen Virol. 2001;82:2709–18.PubMedGoogle Scholar
  6. Wu  JC, Chiang  TY, Sheen  IJ. Characterization and phylogenetic analysis of a novel hepatitis D virus strain discovered by restriction fragment length polymorphism analysis. J Gen Virol. 1998;79:1105–13.PubMedGoogle Scholar
  7. Sakugawa  H, Nakasone  H, Nakayoshi  T, Kawakami  Y, Miyazato  S, Kinjo  F, Hepatitis delta virus genotype IIb predominates in an endemic area, Okinawa, Japan. J Med Virol. 1999;58:366–72. DOIPubMedGoogle Scholar
  8. Watanabe  H, Nagayama  K, Enomoto  N, Chinzei  R, Yamashiro  T, Izumi  N, Chronic hepatitis delta virus infection with genotype IIb variant is correlated with progressive liver disease. J Gen Virol. 2003;84:3275–89. DOIPubMedGoogle Scholar
  9. Casey  JL, Brown  TL, Colan  EJ, Wignall  FS, Gerin  JL. A genotype of hepatitis D virus that occurs in northern South America. Proc Natl Acad Sci U S A. 1993;90:9016–20. DOIPubMedGoogle Scholar
  10. Wang  KS, Choo  QL, Weiner  AJ, Ou  JH, Najarian  RC, Thayer  RM, Structure, sequence and expression of the hepatitis delta (delta) viral genome. Nature. 1986;323:508–14. DOIPubMedGoogle Scholar
  11. Huelsenbeck  JP, Ronquist  FR. MRBAYES: Bayesian inference of phylogeny. Biochemistry. 2006. In press.
  12. Casey  JL, Gerin  JL. Genotype-specific complementation of hepatitis delta virus RNA replication by hepatitis delta antigen. J Virol. 1998;72:2806–14.PubMedGoogle Scholar
  13. Simmonds  P, Bukh  J, Combet  C, Deleage  G, Enomoto  N, Feinstone  S, Consensus proposals for a unified system of nomenclature of hepatitis C virus genotypes. Hepatology. 2005;42:962–73. DOIPubMedGoogle Scholar
  14. Le Gal  F, Gordien  E, Affolabi  D, Hanslik  T, Alloui  C, Deny  P, Quantification of hepatitis delta virus RNA in serum by consensus real-time PCR indicates different patterns of virological response to interferon therapy in chronically infected patients. J Clin Microbiol. 2005;43:2363–9. DOIPubMedGoogle Scholar
  15. Modahl  LE, Lai  MM. Hepatitis delta virus: the molecular basis of laboratory diagnosis. Crit Rev Clin Lab Sci. 2000;37:45–92. DOIPubMedGoogle Scholar
  16. Niro  GA, Rosina  F, Rizzetto  M. Treatment of hepatitis D. J Viral Hepat. 2005;12:2–9. DOIPubMedGoogle Scholar
  17. Martinot-Peignoux  M, Marcellin  P, Pouteau  M, Castelnau  C, Boyer  N, Poliquin  M, Pretreatment serum hepatitis C virus RNA levels and hepatitis C virus genotype are the main and independent prognostic factors of sustained response to interferon alfa therapy in chronic hepatitis C. Hepatology. 1995;22:1050–6. DOIPubMedGoogle Scholar

Main Article

1These authors contributed equally to this work.

Page created: November 17, 2011
Page updated: November 17, 2011
Page reviewed: November 17, 2011
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external