Volume 13, Number 5—May 2007
Dispatch
Fatal Disseminated Acanthamoeba lenticulata Acanthamebiasis in a Heart Transplant Patient
Table
rDNA sequences of Acanthamoeba isolate (2/533) from the patient, a keratitis isolate (GAK1), 3 environmental T5 subtypes, and 4 other genotypes from persons with nonkeratitis infections
Genotype (strain) | DF3 sequence (5′→3′)* |
---|---|
T5 (2/533) | CAAAACACCGCCGTTAATCCTTTTT---CGGGGGTTAACGGTTGGTGAAT |
T5 (GAK1) | caaaacaccgccgttaatccttt-----cgggggttaatggttggtgaat |
T5 (72/2)† | caaaacaccgccgttaatccttt-----cgggggttaatggttggtgaat |
T5 (PD2S)‡ | caaaacaccgctgttaatccttt-----cgggggttaatagttggtgaat |
T5 (FLAIV)§ | caaaacaccgccgttaatcctttt-caacgggggttaacggttggtgaat |
T4 | caaaacacca-Atcggcgcggtcgtccttggcgtcggtccttcacggggccggcgcgagggcggcttagcccggtggcacc |
T1 | caaaacacca-ccatcaggcagtggggtcgtgcttcgcttttccggcaacggggaagtggaggcggtctcattcccctgatgg |
T10 | caaaacaccatccatttagcayggtcgttttcaaatattcctttttgcgaaggttgtttgggaacgattcgtcctgatggatc |
T12 | caaaacacca-ccattaacacgatcgttttttgcaaatatgccacatgcgcaagtgtgtggttgtgtttgaaggaacgatttg |
*Sequences differences are shown in boldface.
†Five isolates at European Molecular Biology Laboratory (EMBL).
‡Eight isolates at EMBL.
§One isolate at EMBL.
Page created: June 23, 2010
Page updated: June 23, 2010
Page reviewed: June 23, 2010
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.